Pigment in mouse fur is produced when the C allele is present. Individuals of the cc genoty white. Fur color if present is determined by the A/a alleles. AA or Aa results in agouti color, esults in black fur. 3. For the following cross, what are the genotypic and phenotypic ratios of the F1 and F2? AACC X aacc . For the following cross, what are the genotypic and phenotypic ratios of their offspring? AaCc X AAcc

Q: Data vs. information: What is the short answer to this question?

A: ANSWER;- - Data is a collection of facts, and information puts those facts into context. -  data is…

Q: Species C: ATGTTCGCCGACCGCTGACTATTCTCTACAAACCACAAAGATATTGGAACACTATACCTA…

A: By submitting your query sequence to the chosen database, do a BLASTn search. By comparing your…

Q: Substance found within mitochondrial membrane responsible for intiation of intrinsic pathway of…

A: The mechanisms of apoptosis are highly complex and regulated, involving an energy-dependent cascade…

Q: Describe post-transcriptional modifications that occur in mRNA and tRNA. Please type your answer.…

A: mRNA is known as massanger RNA. About 3-5% of the cellular RNA are of m-RNA type. It is linear in…

Q: Which eukaryotic organelle is the largest

A:

Q: "Like the lumen of the ER, the interior of the nucleus is topologically equivalent to the outside of…

A: The endoplasmic reticulum and the nucleus are membrane-bound organelles that are constantly in close…

Q: What would most likely result from the damage to the cell

A: Cells are the primary unit of life. Based on the number of cells an organism can be classified as…

Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Name the phase Centromere 7. (with kinetochore) Microtubule attached to kinetochore

A: Metaphase is the stage in which the two identical daughter cells are formed as a result of…

Q: From the above sequence I have copied the first 500bp of the sequence into Word.…

A: To design primers for amplifying the given 500bp region, we need to identify suitable regions to…

Q: The autophagosome fuses with an endosome to form a(n) _____________.

A: Autophagosomes are double membrane sequestering vesicles that are the hallmark of the intracellular…

Q: mitochondria definition

A: They have their own DNA which is similar to bacterial DNA. They have ribosomes, enzymes and…

Q: True or false: cells containing errors are normally eliminated

A: Cells are the smallest unit of the body system responsible for various functions. They go through…

Q: dentify the following structures, please label your answers with the corresponding number and be…

A: Question  72) Reissner's membrane  73) Tectorial membrane  74) Outer hair cells

Q: Translate the following mRNA. Use the space for your answer.…

A: Translation  The process of converting nucleic acid information into amino acids. It is also relates…

Q: his organelle: -is required for translation -acts like a vice to hold mRNA and tRNAs together -is…

A: Translation is the process in which the mRNA transcribed from DNA is translated into proteins by a…

Q: Accumulation of cytoskeletal proteins i.e. neurofilaments seen in Alzheimer disease

A: Alzheimer's disease is assumed to be caused by the abnormal build-up of proteins around the brain…

Q: Describe the levels of cellular organization and state the four types of specialized cells and…

A: Cells are the most basic units of life, these can be prokaryotic or eukaryotic. The different levels…

Q: Label the following diagram: C D В A

A: Introduction Translation is a process by which protein is synthesized in our body. Ribosome is the…

Q: of the blanks and submit X, X' Complex IV of the ETC is reduced by and complex III is reduced by…

A: ETC (electron transport chain) is a chain of electron carriers, which is present in the inner…

Q: A mRNA contains a codon with the sequence 5'-UAC-3'. What would be the most likely sequence of the…

A: tRNA read out m-RNA and synthesize polypeptide chain with the help of ribosome.

Q: Provide a summarizing paragraph of the process of translation (no more than 6 lines)

A: Translation is a process by which our cells synthesize proteins. And it's the part of central dogma…

Q: The cytoplasmic granule of RNA andprotein that reads the message in mRNA isa/an ____________________

A: The central dogma of molecular biology describes the flow of genetic information in cells from DNA…

Q: Give correct typing answer with explanation and conclusion  When ONLY glucose and NO LACTOSE is…

A: lac-operon is an inducible operon which expresses only in the presence of an inducer. Inducer is a…

Q: why stem cell is scientifically or ethically important

A: - Stem cells are important for understanding human development and differentiation. - stem cells can…

Q: With the printer, what type of topology do you need to create a functional liver, and what will you…

A: The liver monitors blood from the digestive organs, processes nutrients, eliminates toxins,…

Q: _____________ is a protein meshwork attached to the inner surface of the inner nuclear membrane.

A: A nuclear membrane is a double membrane structure that encloses the nucleus of the cell. It's role…

Q: There are at least three steps in a generic cell signaling pathway.

A: Generic cell signaling is the process of communication between the cells that allow them to…

Q: B. Transcript and Translate the following: DNA-TACTGATCGACCCCCATAATGAAAATCGGGCCC mRNA- AA- DNA-…

A: Here we are assuming the DNA strand to be the template strand and not the coding strand, becuase…

Q: A Use the information in the passage to identify each of the cell types shown in the drawings.

A: Cells are the basic building blocks of all living things. The human body is composed of trillions of…

Q: Which protein would elute last from a cation exchange column using buffer at pH 7.5? Explain your…

A: The proteins have net charge arising mainly from the amino acid side chain which may either has…

Q: Dynamic instability causes microtubules either to grow or to shrink rapidly. Consider an individual…

A: Microtubules, along with intermediate filaments and microfilaments, make up the cell skeleton, which…

Q: protein in the rough

A: Introduction  The harsh endoplasmic reticulum is a significant site of protein biosynthesis in…

Q: Finding the Disease-Causing Mutation in Nic Volker’s Genome

A: Answer: Introduction: Young child Nicolas Volker failed to gain weight. Doctors at Wisconsin…

Q: TRUE or FALSE. The smallest NON-LIVING thing is a cell.

A: Cells form tissue and tissue forms organ and organ forms an entire organism.

Q: A/An ___ is one of the 13 linear polymers of tubulin subunits that forms a microtubule.

A: The cytoskeleton is made up primarily of microtubules. They are found in all eukaryotic cells and…

Q: Zero tb scedule in yogyakarta for june 2024 pls search in webb

A: Here's a further elaboration and discussion for you to easily comprehend and understand the…

Q: Transfer RNA Selected answer will be automatically saved. For keyboard navigation, press up/down…

A: Introduction :- The physical connection between the mRNA and the protein's amino acid sequence is…

Q: Given that CDKS are "kinases", how do they activate or inactivate other proteins? Why are cyclins…

A: Period between two mitotic division is called as the cell cycle. Cell cycle is the event taking…

Q: Sickle cell anemia occurs due to a point mutation in a gené för changes the amino acid at position 6…

A: Red blood cells are small, round, and convex cells that transport oxygen throughout the body.…

Q: Please briefly explain the terms below. Inheritance, Gene, Catabolic pathway, Ribosome, Compound

A: It is a branch of biology concerned with the study of genes,  genetic variation and heredity in…

Q: What is the corresponding amino acid in the subject? How many nucleotides were inserted/deleted…

A: Bioinformatics is the field of biology that employs computational tools and analysis techniques for…

Q: cell membrane function (detailed explanation)

A: Living substances is a complex mixture of the ions , molecules and the particles organized into the…

Q: ACTIVE LEARNING TEMPLATES System Disorder STUDENT NAME _____________________________________…

A: In a healthcare setting the role of the nurse is to provide care to the patient based on the…

Q: Write a short note on replication of DNA.

A: DNA replication is semi-conservative and bidirectional. It occurs in S-phase of cell cycle. details…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.