Pigment in mouse fur is produced when the C allele is present. Individuals of the cc genoty white. Fur color if present is determined by the A/a alleles. AA or Aa results in agouti color, esults in black fur. 3. For the following cross, what are the genotypic and phenotypic ratios of the F1 and F2? AACC X aacc . For the following cross, what are the genotypic and phenotypic ratios of their offspring? AaCc X AAcc

Q: Please follow instructions and answer completely

A: Proteins are the major macromolecules made up of several amino acids linked together by an amine…

Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: muscular dystrophy: this genetic disease continue to affect many americans and we are not closer to…

A: Muscular dystrophy is caused by a group of disorders that involve a progressive loss of muscle mass…

Q: What is mature mRNA and how it is made. What kind of enzymes are involved in making of mature mRNA?

A:

Q: What is the active site of an enzyme?

A: To catalyze a reaction, an enzyme bind to one or more reactant molecules. These molecules are the…

Q: * ? In BCI, in your opinion which part of the operation is the hardest one

A: BCI is Brain Computer interfaces. BCI is useful for the person who are suffering from neurological…

Q: HindII --- 5' GTC - GAC 3', HaeIII --- 5' CC - GG 3', EcoRI --- 5' G - AATTC 3' and BamI --- 5'…

A: Restriction enzyme varies from one other in their restriction sites as well as the type of ends they…

Q: What is the enhancer element? Select an answer and submit. For keyboard navigation, use the up/down…

A: In genetics, an enhancer is a small piece of DNA (50–1500 bp) that can be linked by proteins…

Q: Next-Generation Sequencing (NGS): NGS is a newer testing technique that is used to identify the…

A: Next-Generation Sequencing (NGS) is a process used to rapidly sequence the nucleic acid in an…

Q: A/An________protein binds to the exposed end of a polymeric molecule preventing further…

A: ANSWER) Carrier protein A/An Carrier protein protein binds to the exposed end of a polymeric…

Q: Transcribe the strand into mRNA: GCA-AGG-TAT-CGT Your answer

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: Cys-His-Glu-Met-Ile-Ser-Thr-Arg-Tyr

A: Peptides are organic compounds made up of amino acids connected by peptide bonds. The specific…

Q: Which of the following statements reflect the difference between RNA and DNA? Multiple answers:…

A: Introduction  The process through which a gene's information is used to create a functioning gene…

Q: From the above sequence I have copied the first 500bp of the sequence into Word.…

A: To design primers for amplifying the given 500bp region, we need to identify suitable regions to…

Q: 1.How is the genetic code of DNA translated in specific protein molecules

A: Most genes possess information that is needed to produce functional molecules termed proteins. The…

Q: Please write a summary about RNA processing:  include all three things that happen during this

A: The process by which immature messenger RNA is converted into mature messenger RNA so that it is…

Q: Please briefly explain the terms below. (10 Points, each term is 2 points) Inheritance, Gene,…

A: Inheritance is also known as heredity. It means passing of traits/qualities from one generation to…

Q: Gene expression is initiated largely in response to changes in  the ____________________________ in…

A: Gene expression in prokaryotes - It includes both the process transcription as well as translation…

Q: 9. The no. pyruvate molecules generated 2 from two moles of glucose in glycolysis 10. This does not…

A: Enzyme catalyzed during aerobic respiration is divided into three major process as Respiration is an…

Q: Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from…

A: Codon is the triplet of either DNA or RNA nucleotides which codes for a specific amino acid during…

Q: In 2023, Yaseen et al (PLoS One) reported on a genome-wide association study looking for genetic…

A: People who strictly consume plants and plant-based food and avoid consumption of meat and food…

Q: histidine

A: Histidine, an essential amino acid, fulfills diverse roles in biological systems, demonstrating…

Q: Which of the following is a nucleotide that is NOT related to heredity? ATGC O RNA DNA O ATP

A: The living organisms contain different biomolecules that includes carbohydrates, proteins, lipids,…

Q: Label the following diagram: C D В A

A: Introduction Translation is a process by which protein is synthesized in our body. Ribosome is the…

Q: 5'-CCGATATAATGAGTCGTCGTCTGGGCCTTCATGTATTCATGGGAAGAGAGTGTAATGTTTGCCTAAGGCC -3 70…

A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…

Q: what is protein sorting ?

A: Protein sorting is the mechanism by which the proteins are transported to their appropriate location…

Q: alphabetical index of your manuals. Why is this such an important rule to follow?

A: ICD-10-CM is International Classification of diseases, Tenth revision, and CM stands for clinical…

Q: Given the double-stranded DNA molecule shown below, what is the sequence of the MRNA corresponding…

A: Given information: Coding strand 5' TATGAAATTTAAATTT 3' Template strand 5' ATACTTTAAATTTAAA 3'

Q: A mRNA contains a codon with the sequence 5'-UAC-3'. What would be the most likely sequence of the…

A: tRNA read out m-RNA and synthesize polypeptide chain with the help of ribosome.

Q: Provide a summarizing paragraph of the process of translation (no more than 6 lines)

A: Translation is a process by which our cells synthesize proteins. And it's the part of central dogma…

Q: Answer True or False Ribosomes released from ER are immature and needs further processing

A:

Q: Offspring #1 B'B'- blue eyes G'G' - curly hair E'E - brown hair Tt - widow's peak Dd - 7 fingers LW…

A: Introduction Genotype is defined as the genetic makeup of an individual organism and it is the sum…

Q: Consider the following MRNA (in red) and the corresponding membrane protein it codes for. What are…

A: In cells, this is a kind of RNA. The genetic information required to produce proteins is carried by…

Q: in the series: SCD, TEF, UGH, ___, WKL what letters should fill the blank

A: The first letter of an element in the series is consecutive to the previous elements first letter…

Q: With the printer, what type of topology do you need to create a functional liver, and what will you…

A: The liver monitors blood from the digestive organs, processes nutrients, eliminates toxins,…

Q: Put the following structures in order from smallest to largest. chromosome (DNA) eukaryotic cell…

A:

Q: _____________ are molecular machines that excise introns from pre-mRNA and then join exons together.

A: In eukaryotes, the RNA transcript that is formed by transcribing a DNA molecule is termed pre-mRNA…

Q: the purpuse of mRNA in regard to producing protein

A: Transcription:As deoxyribonucleic acid (DNA) is bound within the nucleus but a synthesis of protein…

Q: Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop…

A: mRNA or messenger RNA contain the genetic codons that must be translated into amino acid chain…

Q: 3 I 4 . 1. 5 6 241 Organize Your Thoughts: Look at the images below. Determine the correct order…

A: DNA replication is the process by which double stranded DNA molecule is copied to produce two…

Q: A ________ is a recognizable folding pattern involving at least 2 secondary structures and the…

A: Proteins are primarily synthesized as a linear chain of amino acids linked together via peptide…

Inheritance and Mendelian Genetics

Inheritance means the passing of traits to offspring from parents. These traits could be passed either through asexual reproduction or sexual reproduction. The offspring receives the genetic material from the parents. Mendelian inheritance is a certain biological inheritance that follows the rules and principles laid down by Gregor Mendel in 1865. The initial hypothesis was considered wrong, but other inheritance theories modified the concept of inheritance and thus genetics.