ntrolling the cell cycle. Earlier researchers ha frog eggs (Xenopus) contained all the necess ired for DNA replication. This included protei noting factor (MPF). At the time of this study, ity and the research group wanted to test usi 1. In Figure 1 (a) MPF activity was tested for it ne (H1 in snerm chro matin ove hromatin ortain p

central Dogma 2. Fill in the following chart regarding the Central Dogma: ot lfe Transcription Translation Goal (outcome) Required molecules Location where it OCcurs Post-event modifications Identify the three main types of RNA and explain the function of each. In all KNA are present This 3 car organmo. mesunger eun) Riboma (GPnA)

Hello I need help with the blanks.

Please ASAP. Thanks

Multiple Matching. Fill in the blanks with the words below that apply.18. ________ site of protein synthesis19. ________ carries the codon20. ________ carries the anticodon21. ________ a process synonymous with mRNA synthesis22. ________ bacteriophages participate in this transfer23. ________ duplication of the DNA molecule24. ________ process in which transcribed DNA code is deciphered into a polypeptide25. ________ involves plasmidsreplicationtRNAconjugationribosometransductionmRNAtranscriptiontransformationtranslationnone of these       PreviousNext

R and DNA Fingerprinting {T} MYEN 22. Below is a DNA double helix coding for a very small polypride. 5' Nontemplate Strand L TITTATGCGCCCCAGTAAGTAATGACTA AAAATACGCGGGGTCATTCATTACTGAT 3' Template Strand 5' 212 3' a. What is the direction of synthesis for the mRNA? b. Draw the m-RNA that would be transcribed (labeling the 5' and 3' ends) and circle the initiator codon. c. Which end of the mRNA is transcribed first? d. Using the genetic code table, list the amino acid sequence resulting from this mRNA. e. Identify the maximum number of amino acids in a polypeptide chain produced by a DNA containing 225 nucleotides. f. The codons UGA, UAA, and UAG code for which amino acid? g. If a polypeptide is 210 amino acids long what is the minimum number of nucleotides in the mRNA molecule required for the synthesis of that chain?

GENETICS - help me please

Help me please