Norepinephrine acts on heart muscle cells by: Group of answer choices blocking the action of calcium. increasing heart contractility. causing a decrease in stroke volume. causing threshold to be reached more quickly. more than one of the above.

Norepinephrine acts on heart muscle cells by: Group of answer choices blocking the action of calcium. increasing heart contractility. causing a decrease in stroke volume. causing threshold to be reached more quickly. more than one of the above.

Medical Terminology for Health Professions, Spiral bound Version (MindTap Course List)

8th Edition

ISBN:9781305634350

Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Publisher:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder

Chapter4: The Muscular System

Section: Chapter Questions

Problem 53LE: Pain in the leg muscles that occur during exercise and is relieved by rest is known as...

See similar textbooks

Related questions

Q: Explain the process of digestion in medical terms from the mouth to the anus. Include where each…

A: The process of digestion is a complex series of events that occur from the moment food enters the…

Q: Becca loves German Shepherds and wants to have one as a pet. She locates a breeder and agrees to…

A: The objective of the question is to identify the type of selection that occurs when humans intervene…

Q: What would cause someone to be immunocompromised? How does this compromised state alter its ability…

A: An individual can become immunocompromised due to a variety of reasons. These can include genetic…

Q: Baking soda + vinegar observation a. Exergonic b. Endergonic c. Feels cold to the touch d. Feels…

A: The question is asking us to identify the correct observation when baking soda is mixed with…

Q: Which of these statements does NOT correctly describe hypercapnia? a. It is observed in…

A: The objective of the question is to identify the statement that does not accurately describe…

Q: Carbon monoxide is considered toxic because it acts on Complex IV. How would the addition of carbon…

A: The answer is the 3rd option: Complex I, II, and III would be reduced and complex IV would be…

Q: Live Culture of Bacillus thuringiensis (Dipel) and B. subtilis (Kodiak) are sold as pesticides. For…

A: Answer is given below Explanation:

Q: Name the three main loopsof the hydrologic cycle. Then, describe how each of the three main loops…

A: The objective of the question is to identify the three main loops of the hydrologic cycle and…

Q: ry A Detail the process of an adaptive immune response, highlighting the key steps involved in the…

A: The immune system produces two primary responses: the immune system's adaptive response, that's is…

Q: A 10-week-old child suffered from a salt-wasting crisis. His adrenal glands were enlarged and other…

A: The objective of the question is to identify the protein deficiency in the child based on the given…

Q: Loses ions Gains Pumps HO ions in High urine volume

A: Homeostasis refers to any process that helps organisms maintain fairly stable conditions that are…

Q: Briefly describe the steps in catabolism of glucose; showing the location where each step happens in…

A: Briefly describe the steps in catabolism of glucose; showing the location where each step happens in…

Q: Your animal cell culture laboratory suddenly suffered from a bacterial contamination. Several…

A: B. The media is probably contaminated with Mycoplasma, due to the lack of cell walls they are the…

Q: Protein Synthesis and Mutation Practice Complete the lines below by determining the mRNA transcript…

A: The method of protein synthesis is central to cellular work and includes transcription and…

Q: 80 Refer to figure 1A of the Science Article. The reduction in animal weight with exposure to higher…

A: The objective of the question is to interpret the data given in the figure 1A of the Science Article…

Q: Based on our current understanding of human biological variation, explain why different human…

A: Based on our current understanding of human biological variation, explain why different human…

Q: Mammal-like reptiles like Gorgonopsid had specialized teeth, different from the uniform peg-shaped…

A: The question is asking whether the mammal-like reptiles, such as Gorgonopsid, had specialized teeth…

Q: Which of the following is an example of virus-encoded molecules modifying signal transduction…

A: The question is asking for an example of how virus-encoded molecules can modify signal transduction…

Q: Handwritten answers preferably. Someone answered before but just copied the answer that is on…

A: Algae are a diverse group of photosynthetic organisms that can be found in various aquatic…

Q: A person is born with a mutation that causes their cells to not have the ability to produce the NADH…

A: The objective of this question is to determine whether a person with a mutation that prevents the…

Q: Identify the acid and conjugate base in each reaction. Calculate the pKa for each acid. List them in…

A: a. Here HC2H3O2 is acid and conjugate base is C2H3O2-Also, H2O is base and conjugate acid is H3O+…

Q: What do scurvy, brittle bone disease, and the hyperextensibility syndrome have in common?

A: Scurvy, brittle bone malady (osteogenesis imperfecta), and hyperextensibility syndrome (regularly…

Q: give precise answer

A: Part 2: You did not include or upload your workbook for your questions. Alternatively, I have…

Q: A 10 month old child whose external genitalia were ambiguous had hypertension and no dehydration. He…

A: The objective of the question is to understand the reason behind the child's hypertension and lack…

Q: What do horses diets consist of and how do their teeth relate to it.

A: The question aims to understand the diet of horses and how their dental structure supports their…

Q: Which is NOT true about the acrchaeopteryx fossil: A) had jaws with sharp teeth B) had three fingers…

A: The objective of the question is to identify the incorrect statement about the Archaeopteryx fossil.

Q: The shape of a heliodor is an X-linked trait. Male heliodors inherit two X chromosomes, while the…

A: X-linked traits are characteristics controlled by genes located on the X chromosome. In humans,…

Q: Describe three characteristics of ambphibians. Think about reproductive needs, psyhical adaptations,…

A: The first characteristic of amphibians to consider is their reproductive needs. Unlike reptiles,…

Q: . Describe the general structure of all cell membranes. How does this membrane structure determine…

A: 1. General Structure of Cell Membranes and Selective Permeability: Cell membranes are composed of a…

Q: The matrix of the mitochondria is analogous to which of the following in chloroplast: a) Outer…

A: The objective of the question is to identify the part of the chloroplast that is analogous to the…

Q: Describe what is meant by the term "superorganism" and provide an example.

A: SuperorganismA superorganism is a complex entity formed by the cooperation of numerous individuals,…

Q: The concept of eco immunology states that biotic and abiotic features influence the evolution and…

A: The human gut harbors a complex ecosystem of microorganisms, collectively known as the gut…

Q: Sarah is trying to build muscle, so she wants a high-protein drink, but she is also…

A: 3. Soy milk6. LactaidExplanation:2% Cow's MilkA lactose intolerance would not be appropriate for…

Q: What is the role of the liver in bilirubin metabolism? O a. The liver converts bilirubin into…

A: Hormones are biochemical messengers that help your body coordinate its various processes. Several…

Q: Scientific studies have shown that the majority of human genetic differences worldwide exist within…

A: The objective of the question is to determine whether the majority of human genetic differences…

Q: 3'- AATAAAAAAGGTCCCAAAAAATTAGGGGAGACGGTACATAAA GAGTAGAGTCATAAATTTTAGAGATGCGTA - 5'

A: Following the hints and considering the complementary strand is required:Complementary DNA strand:…

Q: What is the validity of concern for potential marine extinction? Defend these concerns or lack…

A: Concern for potential marine extinction is undeniably valid given the multitude of threats…

Q: Based on the attached figure (Figure 10.9 in your textbook), what causes K+ influx across the cell…

A: The objective of the question is to understand the mechanism that causes the influx of potassium…

Q: CIIVII Oent. Clean rolesT Phenotype Frequency Allele Frequency Genotype Frequency Environment:…

A: The allele and genotype frequencies of a popular can be calculated by using the equations of…

Q: 9 7 13 14 20 20 2 6 3 110 15 16 16 S 11 12 17 18 19 19 22 23 33 15 22 21 21 27 27 28 24 29 30 30 25…

A: Within the study of evolutionary science, one critical aspect is the timing of significant occasions…

Q: Find a pimary paper discussing the epidemiology of a parasitic infection/infectation and summarize…

A: Parasitic diseases represent a critical public health challenge, particularly in low and…

Q: What are important characteristics of adequate monitoring plans for translocation programs? Select…

A: Translocation programs include the purposeful transportation of individuals from one location to…

Q: Examples of GMOs Correctly classify examples of bacteria, plants, and animals that have been…

A: Genetically Modified BacteriaGenetically Modified PlantsGenetically Modified Animals All Genetically…

Q: The classic inflammatory response (heat, swelling, redness, pain) reflects the communication of…

A: The classic inflammatory response is a complex and coordinated series of events orchestrated by the…

Q: The three Abrahamic religions (Judaism, Christianity, and Islam) are all correctly categorized as:…

A: The objective of the question is to correctly categorize the three Abrahamic religions (Judaism,…

Q: Peripheral blood cell morphology in aplastic anemia is most often: Question 9 options:…

A: The question is asking about the most common peripheral blood cell morphology in aplastic anemia.…

Q: Compared to the above urine test, a blood test for glucose is more accurate in avoiding both false…

A: Diabetes is a condition where the blood sugar level remains elevated. It is of two types - type I…

Q: Which Roman deity was the wife of the first “sky-father”, and the mother of twelve Titan gods and…

A: The question is asking for the Roman deity who was the wife of the first 'sky-father' and the mother…

Q: Put this in a 400-word paragraph The Development of Evolutionary Theory, Lecture 2 This 17th-century…

Q: Expository cause effect essay on malaria

A: Malaria, a disease caused by Plasmodium parasites, is a significant global health challenge with…

Concept explainers

Muscle Action

A change in the body or a bodily organ as a result of its functioning is referred to as an action. Muscle action can be defined as the specific movement of a bodily part generated by the contraction of a muscle. The muscle proteins actin and myosin are the important contractile proteins involved in muscle action. Muscle contraction, in addition to movement, serves several other important functions in the body, including posture, heat generation, and joint stability. Muscle contraction maintains posture, which includes standing and sitting.

Question

Norepinephrine acts on heart muscle cells by:

Group of answer choices

blocking the action of calcium.

increasing heart contractility.

causing a decrease in stroke volume.

causing threshold to be reached more quickly.

more than one of the above.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction

VIEW

Step 2: Understanding how Norepinephrine acts on heart muscle cells

VIEW

Step 3: Explanation of incorrect options

VIEW

Solution

VIEW

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Choose whether the following are positive or negative inotropic agents. positive negative inotropic inotropic Agent epinephrine anoxia Beta blockers acidosis digitalis increased potassium sympathetic stimulation Calcium channel blockers increased calcium thyroid hormones List 6 things (from your PowerPoint) that result in an increase in heart rate.
Saved The therapeutic action of beta-blockers in chronic heart failure is to: Multiple Choice increase the heart rate. increase the actions of norepinephrine and epinephrine. block beta-1 receptors on the heart. increase the force of contraction.
Which of the following combinations would have OPPOSITE effects in changing heart rate? atropine and norepinephrine atropine and a cholinesterase inhibitor epinephrine and norepinephrine acetylcholine and a cholinesterase inhibitor
You are working in cardiopulmonary rehabilitation. It is your patient, Dave’s, first day of rehab. Dave had a heart attack 45 days ago. He is 40 years old and feels comfortable and confident enough to walk on a treadmill or ride a bike. Upon talking with Dave, you learn that he regularly exercised up until his heart attack. He completed resistance training 3 days/week at his local gym and would play tennis with friends several days each week. He can walk comfortably without an assistive device on flat surfaces at his own speed. You need to determine Dave’s VO2 in order to create a correct exercise prescription. Would you test this person, yes or no? If yes, please indicate what protocol you would choose and whether or not the test would be maximal or submaximal? Please include your rationale.
Cardiotonic Drugs (Inotropic). Increase intracellular calcium and allow more calcium to enter myocardial cells during depolarization. Increase force of myocardial contraction. Increase cardiac output and renal perfusion. Slows heart rate, Decrease conduction speed through the AV node Isosorbide mononitrate Digoxin(Lanoxin) Isosorbide Dinitrate Nitroglycerine
Which of the following statements best describes the actions of the neurotransmitter noradrenaline in the heart? Noradrenaline acts on α1-adrenoceptors in the sinoatrial node to increase heart rate. Noradrenaline decreases the rate and force of contraction of the heart. Noradrenaline increases the rate, but not the force of contraction of the heart. Noradrenaline acts on β1-adrenoceptors in the sinoatrial node to increase heart rate.
A drug that blocks the cardiac muscarinic receptor might be expected to: Increased heart rate Decreased heart rate Open mechanically-gated K channels Decreased contractility Decrease pacemaker potential
Which class of antiarrhythmic drugs characterized by their ability to Inhibit the slow inward calcium current Select one: Class I Class II Class IV Class III
Drugs NOT LIKELY to Improve Patient's Condition Drugs LIKELY to Improve Patient's Condition A drug that hyperpolarizes the pacemaker potential A drug that reduces current through T-type Ca?+ channels A drug that reduces current through voltage-gated Nat channels A drug that increases the current through F-type "Funny" channels
A person showing signs and symptoms of a heart attack will often: Panic and faint Deny that they are having a heart attack Take a nap to relieve pain None of the above
Pain in the leg muscles that occur during exercise and is relieved by rest is known as _______________. This condition is due to poor circulation and is associated with peripheral vascular disease.
An increase in which of the following would result in a larger stroke volume ? Group of answer choices End diastolic volume Heart rate Arterial blood pressure