mutations are the most common type of mutations accounting for the majority of all human genetic variation, especially in highly conserved regions. Select one: a. Nonsense O b. Protein folding Oc. Neutral O d. Frameshift Oe. Missense

Faulty DNA repair; ii) Gain-of-function; and iii) Trinucleotide repeats  provide genetics disorders Give examples of mutations with each disorder.

A woman has an egg with a mutation for the gene that expresses whether the child can produce lactase enzymes. Here is the new nucleotide sequence with the change in bold. 3’ – ACCTCTTACTTCTATATATAGGGAAGACTAATTGTC – 5’   what type of mutation is this?   Will this affect the child's abilty to produce lactase enzymes needed to digest lactose?

please answer the full question