
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question

Transcribed Image Text:Match the terms associated with the polymerase chain reaction with their correct descriptions.
Refers to the fact that DNA molecules get longer the more of them there are in the reaction.
A.
В.
Heat the sample to a high temperature (usually 94°C) to separate all DNA strands from each other.
Denaturation
C.
Incubate the reaction at the optimal temperature for the primers to base-pair with each other.
Annealing.
D.
Incubate at a low enough temperature (usually-55°C) so that primers base-pair with their complementary sequence.
Extension.
Add a chaotropic agent that destabilizes hydrogen bonding.
E.
Amplification.
F. Incubate the sample at a temperature that is optimal for thermostable Taq DNA polymerase (usually -72°C).
G.
Happens after repeated cycles of the temperature change regimen.
Refers to the quadrupling of the target DNA sequence in every cycle of the temperature regimen.
Н.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps

Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- E. coli cells are simultaneously infected with two strains of phage λ. One strain has a mutant host range, is temperature sensitive, and produces clear plaques (genotype h st c); another strain carries the wildtype alleles (genotype h+ st+ c+). Progeny phages are collected from the lysed cells and are plated on bacteria. The following numbers of different progeny phages are obtained: Progeny phage genotype Number of plaques h+ c+ st+ 321 h c st 338 h+ c st 26 h c+ st+ 30 h+ c st+ 106 h c+ st 110 h+ c+ st 5 h c st+ 6 a. Determine the order of the three genes on the phage chromosome. b. Determine the map distances between the genes. c. Determine the coefficient of coincidence and the interferencearrow_forwardBriefly describe the two approaches a bacteriophagecan take to trigger an infection once inside its host cell.arrow_forwardTranslate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:arrow_forward
- RNA-dependent RNA polymerase performs which of the following functions? O 1) Uncoats the viral genome 2) transcribes retroviral RNA genomes into DNA 3) Replicates RNA into RNA O 4) Replicates DNA into RNA 5) Shuttles RNA genomes into the nucleus for assemblyarrow_forwardIn the Hershey Chase experiment, why was the localization of radio-labeled phage of macromolecules in the cytoplasm the reason that the genetic material identity was proved.arrow_forwardBriefly describe the lytic and lysogenic cycles of bacteriophages.In your answer, explain what a prophage is?arrow_forward
- With respect to DNA and RNA polymerases which statement is correct? A) Only DNA polymerases are DNA template driven. B) Only DNA polymerases require primers. OC) Only RNA polymerases are DNA template driven. OD) Only RNA polymerases require primers. E) Both require a DNA template, activated monomer units and a primerarrow_forwardThe {choose } options are transformation, conjugation, or transduction.arrow_forwardCan you please answer 18, and 19arrow_forward
- O O O A new virus is discovered. Its RNA genome encodes several proteins, including a reverse transcriptase enzyme. What can you conclude about replication of this virus? Its replication involves a double-stranded RNA intermediate Its replication involves a DNA copy of its genome Its replication depends entirely on cellular enzymes Its replication is entirely independent of cellular enzymes 00 A deficiency in Base Excision Repair (BER) would primarily sensitize you to mutations caused by radiation, X-rays O Chemicals in smoke, and UV radiation O Unavoidable, spontaneously occurring DNA damagearrow_forwardConsider a hypothetical phage whose DNA replicates exclusively by rolling circle replication. A phage with radioactive DNA in both strands infects a bacterium and is allowed to replicate in a nonradioactive medium. Assume that only daughter DNA from the elongated branch ever gets packaged into progeny particles. What fraction of the parental radioactivity will appear in the progeny phage? How many progeny phage will contain radioactive DNA? What is the fundamental difference between the initiation of θ replication and that of the rolling circle?arrow_forwardBacteria exposed to viruses incorporate sections of the virus’s DNA into the CRISPR array sequences in their genome. This mechanism allows bacteria to fight off the viruses, like an immune response: the information in CRISPR spacers served as “coordinates” for recognizing and cutting up invading DNA sequences. Describe what might happen under the conditions described after a bacteriophage infects a bacterial cell and releases its DNA into the bacterial cell. Explain why: 1. The invading phage DNA is recognized by the Cas proteins but not inserted into the CRISPR array region of the bacterial genome: The bacteria will be unable to elicit an immune response and will succumb to the phase infection 2. The cas genes on the bacterial genome contains a missense mutation that increases its cleavage/cut activityThe bacteria will elicit an immune response that will successfully fight the phage infectionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education

Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education