Answered: MAKE CONNECTIONS How do the tails…

Science

Biology

MAKE CONNECTIONS How do the tails account for the hydrophobicnature of fats? (See Concept 3.2.)

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter3: Biological Molecules: The Carbon Compounds Of Life

Section: Chapter Questions

Problem 13TYK

See similar textbooks

Related questions

Q: Draw every step involved in the chemical synthesis of the dinucleotide (5')CG(3'). Show molecular…

A: The nucleic acid is a macromolecule that is found in all living organisms and the DNA is a class of…

Q: Precipitation of Proteins by Heavy Metal Salts

A: Introduction: The term protein is derived from the Greek word proteios, meaning holding the first…

Q: LEARNING OBJECTIVE ENE-2.A Describe the roles of each of the components of the cell membrane in…

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,…

Q: 3. Given the partial sequence of a peptide: ILWANRMSHVLFAVE A Which amino acid residues would you…

A: We are authorized to answer one question at a time since you have not mentioned which question you…

Q: proteins? a. High pressure drives protein conformational equilibria towards the physically larger…

A: Protein denaturation is the process in which the proper structure of the protein which is either in…

Q: 10. The final conformational shape of proteins and interactions with their environment and other…

A: Protein folding depends upon its outer environment. Polar amino acids present towards outside when…

Q: Calculate isoelectric point of asp, leu, tyr, his and lys.

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Select all that apply. The primary structure of a protein: is determined using NMR methods. can be…

A: The chains of amino acids joined by peptide bond form the protein. It is mainly present in animal…

Q: Select all that apply. This is an image of a plasma membrane, which consists of two layers of…

A: The plasma membrane is present in all cells that separate the interior from its outside environment.…

Q: 1. In a protein, why does when Ala is replaced with Ile, it loses its activity but when Lys is…

A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…

Q: (Biological Molecules) How Bread, Meat and Olive oil Interrelated?

A: The biological molecules are carbohydrates, fats, amino acids and nucleic acids. The lipids are…

Q: WHAT IF? How would the membrane lipid composition of a native grass found in very warm soil…

A: Cell membrane acts as a boundary that separates the content of cell from the extracellular…

Q: Draw the structure of 2 five-mers (draw backbones with side chains shown as R groups) forming a beta…

A: The secondary structures of proteins are the alpha helix and beta sheets. Alpha helix forms a spiral…

Q: 1a-The separation of the parent cell into two daughter cells fails to occur during the process of…

A: Binary fission is a type of asexual reproduction and most common inside the prokaryotes . Due to…

Q: Adaptin 2 (AP2) was the Mickey Mouse aciking structure that we saw in class. Those proteins are…

A: various types of bond forms between proteins.

Q: What are the structural features of 7N7H (Viperin-like enzyme)? a) Must show 3D structure

A: An enzyme is a biological catalyst. it is usually protein. 'Viperin' is a member of the radical…

Q: 2. Evaluate the secondary structure of proteins. Which of the following differentiates alpha…

A: Protein primary structures are amino acid sequences and the spatial arrangement of these sequences…

Q: Although it will likely never be recognized by the general public, lipid nanoparticals are the…

A: Lipid nanoparticles are now widely used for the cure of COVID-19 by the vaccines. Liposomes are the…

Q: - Take note Of the imporfant functions of proteins Give an example of cach. 2. Describe in no more…

A: Large, intricate molecules known as proteins perform a variety of vital functions in the human body.…

Q: How the protein structure become stabilized and why the proteins function become halted with…

A: Proteins are the essential biomolecules formed by the joining of the polypeptide chains. These…

Q: 3. With suitable examples, compare the structural and functional differences between a fibrous and…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Which method can be used for structure prediction of “Harder Target” Proteins and Why? Also write…

A: Prediction of protein structures using bioinformatics can include sequence similarity searches,…

Q: Proteins, the building blocks of life, have several functions in the human body and all the…

A: Enzymes are typically protein molecules that speed up the rate of chemical reactions. In other…

Q: Vhich statement most accurately characterizes the effect of high temperatures (above 37 celsius) on…

A: Protein folding is a process by which a polypeptide chain folds to become a biologically active…

Q: Q1: Protein Structure Matching: Match each term with its correct definition. Primary Structure…

Q: 2) Sugest I strategy frr golhers of A. b) write alown peptide sequence with bath 3 1. letted and c)…

A: Amino acids are the building blocks of proteins which are composed of amino group (NH3+), carboxyl…

Q: Q4. Describe the four levels of protein structures. Include information about the bond between amino…

A: There are four levels of protein structures:- Primary Secondary Tertiary Quaternary Primary…

Q: Choose thẻ C. Carbohydrates form part of the structural framework of DNA and a. Glycoprotein…

A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: How do I organize Fibrous and Globular Protiens and what is incorrect in the picture below?

A: Characters of fibrous proteins are as follows:1. Structure is rod like2. Insoluble in water3.…

Q: B. Sketch an example of a hydrophobic interaction (hydrophobic pocket) that could be Found in a…

A: Hydrophobic interactions are used to describe the interactions between hydrophones and water…

Q: Chemistry A biomolecule has a K_d of 1.6mM. A mutated-version of the same biomoleucel was bound by…

A: [P] + [L] → [PL] Dissociation constant, Kd = [P] [L] / [PL] Dissociation constant (Kd) - is…

Q: Does your protein 3GRS have a quaternary structure??? talk about the tertiary structure of 3GRS.…

A: All molecular models (atomic coordinate file) based on the X-ray crystallographic data of the…

Q: GTTTTCACTGGCGAGCGTCATCTTCCTACT 10. Generate a secondary structure prediction for one identified…

Q: Q17. Draw the structure in which lipids are aligned when placed in water? What is this structure…

A: Since you have asked multiple question, we will solve the first question for you. If you want any…

Q: Fibrous proteins characteristically have a hydrophobic interior and a hydrophilic surface.…

A: Protein structure is the three-dimensional arrangement of amino acid polymers specifically the…

Q: ACTIVITY 7.1.2 Write the structural formula of dATP, DTTP, DCTP, dGTP, UTP, and give the complete…

A: Introduction: Deoxyribonucleic acid is made up of subunits called nucleotides. Each nucleotide…

Q: 2. A functional protein that is approximately 110 kDa in size has all its cysteine residues joined…

Q: Draw the peptide linkage for the word CHEMILUMINESCENCE Indicate how many water molecules will be…

A: Peptides are composed of a linear chain of amino acids attached together via peptide bonds. Natural…

Q: Explain the significance φ, ψ contour diagram in proteins and explore how is it interpreted?

A: The contour plot of phi and psi dihedral angles is also called the Ramachandran plot. Ramachandran…

Q: 1. Fact Check Match the following statements about protein struc- ture with the proper levels of…

A: The polypeptide chains are folded into their native conformations in order to become biologically…

Q: 5. Refer to Model 2 for information relevant to this question. A sample of the peptide Lys net…

A: Amino acids are organic compound having two functional group namely carboxyl and amino group. Some…

Q: LLNSAMSRLYSLRSS 1.Assuming this sequnce is enitrely alpha helical what is the hydrogen bond donor…

A: The α-helix is an ordered secondary conformation of proteins. An α-helix is stabilized by the…

Q: 3. A. As the bulk solvent in biological systems, water exerts a huge effect on protein structure and…

A: Proteins are the building blocks of life. Proteins are made up of amino acids. Amino acids when they…

Q: Explain the biological function of achieved by the coiling of polypeptide chains as well as the…

A: A coiled coil is a structural motif in proteins in which 2-7 alpha-helices are coiled together like…

Q: 2. State the four types of attractive interactions that give rise to tertiary protein structure. 3.…

A: Protein structure has different levels of conformation. They are, the primary structure, secondary…

Q: Q:All of the following types of interactions co-operate in stabilising the tertiary structure of…

A: Protein is a substance consists of amino acids. Protein is present in all living organisms and is…

Q: Q. In protein structure modelling, how you identify the best model? Name and explain the parameters…

A: The protein is studied as primary, secondary, tertiary, and quaternary structure. It is studied…

Q: How do the levels of structure achieved in proteins?

A: Amino acids are monomers of protein they are linked with each other by forming peptide bonds. Amino…

Concept explainers

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.

Question

MAKE CONNECTIONS How do the tails account for the hydrophobic
nature of fats? (See Concept 3.2.)

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

MAKE CONNECTIONS Considering the chemical characteristics of the amino acidsvaline and glutamic acid (see Figure 5.14), propose a possible explanation for the dramaticeffect on protein function that occurs when valine is substituted for glutamic acid.
. Consider a small protein containing 101 amino acid residues. The protein will have 200 bonds about which rotation can occur. Assume that three orientations are possible about each of these bonds. (a) Based on these assumptions, about how many random-coil conforma- tions will be possible for this protein? (b) The estimate obtained in (a) is surely too large. Give one reason why.
Part I. Protein structure You have the toy model for a protein in the water (W) environment of the cell shown. a) How many residues (amino acids) does this toy protein have? b) How many hydrophobic (H), hydrophilic (P), and charged (C) residues are there? c) Sketch the molecule on your answer sheet and then show the positions of the favorable C-C (charge-charge) interactions on the figure.
Give typed full explanation What is the net charge of cysteine in an aqueous solution at pH 9? Carboxyl group pKa = 1.92; Amino group pKa = 10.70; Side chain pKa = 8.18
pls help ASAP, thank you! “which feature of protein folding is NOT accurate?”
. Pick all that are TRUE regarding analysis of quaternary structures of proteins using polyacrylamide electrophoresis:I. The added β-mercaptoethanol disrupts S--S bonds bridging the polypeptide chains causing the appearance of higher Rf bands compared to the native protein run. II. Heating up any protein before subjecting to SDS-PAGE will always result in the formation of more than one band.III. A good asymmetrical gel layout would be : (Lane 1) MW ladder, (2) native protein, (3) protein + β-ME, (4) protein + HCL, (5) protein + β-ME + HCl.IV. Formation of a single band in the protein + β-ME + HCl run, whose Rf is lower than the native run, could be indicative that the protein is a homodimer.A. I onlyB. I and IIC. II and IIVD. None is true
On 4. Below is a polypeptide with an unknown number of amino acids. On the diagram below: a. Circle EVERY peptide bond b. Circle and number each amino acid from 1, 2, 3, and so on; from left to right c. Label each amino acid as polar, non-polar, or electrically charged d. Label the N-terminus and C-terminus e. Select three pairs of amino acids that could potentially interact to influence tertiary structure AND state the bond/force/interaction type involved in each pair. H₂N-CH-C-N-CH-C- CH₂ CH₂ CH₂ NH CINH NH₂ Accessibility: Investigate CH₂ -NH -CH-C-N- CH-OH CH3 -CH-C-N CH₂ CH₂ -N- OH CHIC-OH CH₂ OH
Please, need help with the explanation and diagram. The structure and properties of poly peptides: A) Describe the type of bonding that would occur when three amino acid monomers (include a diagram of the amino acids) form a tripeptide and describe how such bonds could be formed. B) During the period of Chemical Evolution, what is the significance of the structure of the polymer formed? (Include a diagram)
A hypothetical protein has a molar mass of 23,300 Da. Assume that the average molar mass of an amino acid is 120. • How many amino acids are present in this hypothetical protein? • What is the minimum number of codons present in the mRNA that codes for this protein? • What is the minimum number of nucleotides needed to code for this protein?
. Suppose you have two genetic variants of a large protein that differ only in that one contains a histidine (side chain pk, = 6.0) when the other has a valine (uncharged side chain). (a) Which would be better for separation: gel electrophoresis or isoelectric focusing? Why? (b) What pH would you choose for the separation?
Protein Concept Map Add these terms to your concept map should include these concepts and details: Structure (functional groups, shape); Monomer; Linkage; Properties; Functions; Key terms from the Partial List of Key Terms from the Minds Partial List of Key Terms essential amino acid amino acid side group/R-group peptide bond polypeptide receptor neurotransmitter hormone secondary structure tertiary structure quaternary structure fair test hydrophobic hydrophilic intermolecular force of attraction
multiple choice question: what R groups of the amino acids would most likely be found in the core of globular protein in an aqueous solution? (a) Ser & Thr (b) Ile & Phe (c) Glu & Gln (d) Asp & Lys (e) Trp & His