Make a dichotomous key for Aye aye Human Pig Giant bear Koala

Q: expanded structure of the D-tagatose Fischer projection of D-tagatose Haworth projection of…

A: The objective of the question is to understand the different structural representations of…

Q: Name 2 things the ABO gene codes for besides blood type

A: ABO gene contains 7 exons and is located on the short arm of chromosome number 9.

Q: A animals in wildlife park Some the AH-M3N М 2 Draw I x x x A, H, I, M, W, z cant crosses: X X as…

A: The chromatic number of a graph is defined as the minimal number of colours required to colour the…

Q: Place each term or phrase in the proper position to identify the item or process being addressed.…

A: Reactions consisting of both oxidation and reduction steps are called redox reactions, where in the…

Q: Predict the structure of a cruciform that could be formed from this oligonucleotide.…

A: Oligonucleotides are a short segment of DNA or RNA. They consist of around 12 to 27 nucleotides.…

Q: 8. Which is the correct description of the human chromosome number? * O2n =23 (where n=23, the…

A: Chromosomes are long, thread-like structures made of DNA and protein molecules that carry genetic…

Q: Many insects have a “lock and key” type of genitalia in which the male reproductive structures will…

A: Reproductive isolation is an evolutionary mechanism, physiological process, and behavior that are…

Q: Inter specific hybrid if they survive are

A: Interspecific hybrid  When two different species from the same genus are mate and produce their…

Q: 7. Label the three main parts of a nucleic acid in Figure 3. 70 (b) (a) OIP 0 0 || 0-P-O-P-0-P-0-CH₂…

A: In biological systems, genetic information is stored in a chain of nucleotides called a nucleic…

Q: why do we use chimera for possible organ transplantation? Why not use only pig or monkey as their…

A: Chimera is an organism or tissue that contains at least two different sets of DNA, most often…

Q: Frequent injections of insulin are often required in order to treat the disorder known as diabetes.…

A: Diabetes is a lifelong health disease (long-lasting), affecting the way the body transforms food…

Q: Nucleotide Site 3 4 9. 10 Outgroup C G Sislaf rose C G G C G т C T Glozzom rose G G G A Pentwist…

A: Taxon on a tree A phylogeny, or evolutionary tree, represents the evolutionary relationships among a…

Q: Which of these statements about nucleosomes is FALSE? More than one of these answers is false all of…

A: Ans.-Nucleosomes are found in prokaryotes. This is FALSE.Nucleosomes are only found in…

Q: To have success in the following problems, make a copy of the following table for yourself and…

A: Complementation Complementation is defined as an event in which the mutant phenotype of the…

Q: Help me answer this —> One day you were running around the neighborhood park with a bag full of…

A: there are three varieties of grasshoppers: 1. green coloured 2. brown coloured 3. green and brown…

Q: Discuss ways that the cryobiology (“freezing biology”) of insects could be manipulated to control…

A: Preservation of the genetic material can be done for various purposes. It is studied under the…

Q: Why is the DNA yield higher from 1g of strawberry compared to 1g of Arabidopsis leaves when both are…

A: Deoxyribonucleic acid is a molecule that contains the instructions that enable an organism to grow,…

Q: Why is the DNA yield higher from 1g of strawberry compared to 1g of Arabidopsis leaves when both are…

A: All living organisms contain genetic material. The majority of the organism has DNA as the genetic…

Q: X-Chromosome Inactivation in mammals results in the formation of what structures that can be seen in…

A: Humans have 23 pairs of chromosomes. Out of these 23 pairs of chromosomes 22 pairs are autosomes and…

Q: Exon duplication of multiple alpha-helix coding domains is thought to be responsible for the origin…

A: Vertebrates have spinal cord which remain surrounded by bone or cartilage. Mammals are vertebrate…

Q: How are polyribosomes different in prokaryotes and eukaryotes? In eukaryotes they can form right up…

A: DNA The genetic material which is made up of two long chain of nucleotides which runs in opposite…

Q: Give correct typing answer  to all parts ?

A: Please see attachment below for answers and explanation.Explanation:Step 1:To calculate…

Q: What will be the effect of mutation that turns lysine to arginine

A: The mutations occur in genomic DNA but they will reflect in the form of protein sequence and…

Q: A lac I mutant allele that encodes a protein not capable of binding DNA is a: O Antimorph O…

A: In genetics, mutant alleles are variations or changes in the DNA sequence of a gene that can lead to…

Q: You are studying a mammalian mitochondrion gene that has the sequence below. What is the amino acid…

A: To determine the amino acid sequence, we need to translate the mRNA sequence derived from the sense…

Q: Explain the disadvantage of caponization

A: Capsonization Is a surgical technique in which the sexual behaviour of male chickens are altered.…

Q: A B 0000 0000

A: Please follow step 2 for detailed explanation.

Q: Zoology 05: Taxonomy Lab/ Tree Building Exercise Group Members: Section 1. Name the organisms (be…

A: In order to explain the relatedness among different species different characters are chosen and on…

Q: describe the term replicon

A: Replication is a process thatindudes various proteins and their complexes to form copies of DNA…

Q: expalin Yeast centromeric DNA sequences

A: Centromere, also known as kinetochores are DNA sequences that are involved in linking a pair of…

Q: Can UVC light wands kill COVID-19

A: COVID-19 is the disease caused by a new strain of coronavirus, severe acute respiratory syndrome…

Q: H3K4me3 means Histone 3, Lysine residue #4 methylated with three methyl groups O True O False

A: Histone modification is the covalent modification of histone proteins, which are responsible for DNA…

Q: 1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the…

A: Introduction  DNA (Deoxyribonucleic acid) sequence is the order of nucleotide bases (adenine,…

Q: Can COVID-19 kill a 14 year old

A: COVID-19 stands for Coronavirus disease, This is an infectious disease which is caused by a…

Q: Species I is diploid (2n = 8) with chromosomes AABBCCDD; related species II is diploid (2n = 8) with…

A: Chromosomal mutation is defined as the change in structure, number or size of chromosome. Types of…

Q: What is lignin and its role in plants? Why can reducing the amount of lignin in trees enhance the…

A: Note:- Sticking to our guidelines I have answered only ist three questions. Please ask rest of the…

Q: Determine the results of an insertion of TA between positions 2 and 3.

A: 5' GTAGGGAGAACGAGACAATCTG  3' DNA 3' CATCCCTCTTGCTCTGTTAGAC  5'   5'GUAGGGAGAACGAGACAAUCUG 3' mRNA…

Q: What is the function of the rough ER and the smooth ER?

A: The endoplasmic reticulum is a network of tubular membraneous structures that are present only in…

Q: H₂C-O-C-(CH₂) 16CH3 i HC-0- H₂C-O-C-(CH₂) 14CH3 (a) -(CH₂)7CH=CH(CH₂)7CH3 H₂C-O-C-(CH₂) 14CH3 요…

A: Fats and oils are triglycerides or triacylcylgerols. They are esters which three fatty acid are…

Q: 7. Using the diagram on the left, the molecule coded directly from DNA is represented by what…

A: Instead, the DNA is used to create a messenger RNA (mRNA) molecule, which then controls the…

Animal Phylogeny

Cladistics is a method of biological classification where organisms are classified based on their ancestors and their relationship with them. It is defined as the concepts and methods for determining the branching patterns of evolution and evolutionary history. Some scientists, however, have preferred the term phylogenetic systematics or phylogenetic taxonomy to emphasize the reliance on a phylogeny for classification. It is the most common and accepted method for classifying organisms.