Q: rovide a detailed description and hand-drawn figure for each of the following. (1) DNA…
A: DNA REPLICATION:- It is the process of making two identical daughter copies of DNA from the one…
Q: The inability of DNA polymerase to replicate the ends of linear chromosome in one strand, compare…
A: Introduction The biological process of producing two identical copies of DNA from a single original…
Q: DNA database growth and use in the USA
A: DNA database is a repository of the DNA profile which is used to identifying criminals, DNA…
Q: Strandi rection of winding 3' Strand 2 b diagram shows a replication fork. What is the polarity of…
A: The Okazaki fragments are important for DNA synthesis because there is no 3' to 5' strand of DNA for…
Q: 37. Telomere Repetitive DNA found near the centromere of higher eukaryotes В. Specialized structure…
A: Since you have posted multiple questions, we will solve the first question for you. If you want any…
Q: Wxplain why the 5’-to-3’ rule creates a conundrum during replication.
A: Answer
Q: Compare and contrast Replication of DNA in prokaryotes and eukaryotes
A: Definition: - PROKARYOTES: - Prokaryote i s amicroscopic snigle celled organism which has niether a…
Q: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Complementary DNA sequence:…
A: Process by which DNA is copied to mRNA is called transcription. Process by which mRNA is used to…
Q: Re-write the following false statement to make it true: A bacterial replication fork is…
A: DNA replication is the process by which the piece of DNA undergoes duplication. It is conducted with…
Q: strand and its complementary : 5'-ATTACAG-3' umber of hydrogen bonds between strands: + TOOLS x10
A: The nucleotides forming each DNA strand are connected by noncovalent bonds, called hydrogen bonds.…
Q: Yeast artificial chromosome how the synthesised?
A: Yeast artificial chromosome (YAC) is a human-engineered DNA molecule used to clone DNA sequences in…
Q: Which musical instrument does the replication process resemble? O tuba O trumpet trombone
A: Replication is an important process that takes place in all organisms that ensure the maintenance of…
Q: BamHI Haelll Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 How long is the original DNA molecule?
A: If it is a closed circular DNA, BamH1 cut it into three fragments of length 10kb 5kb 2kb
Q: number 7 and 7a
A: If the given plasmid is digested with the restriction enzymes HindIII, ApaI, PvuI, and PvuII then…
Q: What is the gel-like region formed by the chromosome called?
A: Chromosome is a compact form of DNA wrapped around some proteins. It is generally seen in dividing…
Q: iginal mplate) HA denine Thymine Cytosine Guanine nzymes and structures to label: hromosome…
A: A chromosome is a long DNA molecule with part or all of the genetic material of an organism.Most…
Q: op an analogy for the processes researchers use to make changes to DNA. In y gy, explain how it is…
A: Gene editing is the process by which researchers make changes in the DNA sequence. Gene editing…
Q: expalin what is the function of chromosomal DNA?
A: Gene: Genes are a functional unit of heredity. It contains information that determines what the…
Q: DNA coding strand ATG GGA ATT CGC can not get this what the sequence of the complementary template…
A: The DNA strand which functions as template for RNA synthesis is known as template strand, minus…
Q: slation The following is the base sequence of an exon portion of a template strand of a DNA…
A: In this question we are provided with information regarding DNA template strand and we have to find…
Q: Rolling circle replication is used to copy the bacterial chromosome. plasmids and some…
A: Phage uses most of the host cell machinery to replicate its genome. Its genome contains a minimal…
Q: Explain why the image below could not be from a eukaryote. What characteristics of the image would…
A: Eukaryotes are organisms that has nucleus and organelles within the cell. Nucleus is enclosed in the…
Q: SQ4 Diagram how replication slippage changes an STR with 4 repeats into an STR with 5 repeats. The…
A: Replication slippage is also known as slipped strand mispairing (SSM). It is a process of mutation…
Q: Acts at oric to initiate DNA replication by denaturing dsDNA Choose... Counteracts topological…
A: DNA replication is a complex process which involves replicating another strand of DNA according to…
Q: will synthesize the in short pieces that are linked together by the enzyme , but the is made…
A: Deoxyribose nucleic acid (DNA) is the genetic material for almost all living organisms. DNA is a…
Q: Online Tools Juan Bonilla Velasquez Nimitz 20-21: CA Biology Pros Question 4 6C) A section of a…
A: DNA is the genetic material of most living organisms and it contains many genes that code for a…
Q: Compare and contrast the mechanisms by which bacterialcells and eukaryotic cells package their DNA.
A: Nucleic acids, DNA, and RNA are composed of nucleotides. Each nucleotide is composed of a…
Q: Why bacterial chromosome is circular?
A: Bacteria are single celled microorganisms and their cell structure is simpler than the other…
Q: Match term and its description. heat briefly separate DNA strands |Choose cool to allow primers to…
A: PCR ( polymerase chain reaction ) is a methodology involving synthesis of numerous duplicates or…
Q: Name of the enzyme that adds RNA Nucleotides during Transcription? O Helicase O Primase ODNA…
A: Option 4 is the answer.RNA polymerase.
Q: Replication Centromere O Unreplicated, homologous Replicated, homologous O Unreplicated, identical…
A: According to the question, in the following image C and D are ........... and ..............…
Q: DNA Protein Synthesis Test STRUCTURE OF DNA Finish the sentence by choosing the correct answers.…
A: Rosalind Franklin has actually discovered and photographed the helices of the ribonucleic acid and…
Q: Write notes on RAPD, microsatellites DNA, AFLP.
A: Deoxyribonucleic acid (DNA) is a hereditary molecule that passes genetic information from one…
Q: nce of Bacteriophage.
A: The Significance of Bacteriophage:
Q: polymerase EXCEPT: / Almal geld vir DNA-polimerase, BEHALWE: A. generates dsDNA from SSDNA /…
A: DNA polymerase enzymes are important during replication. Their function is to add nucleotides to…
Q: Correct order ib which the following enzynes would operate to fix a damaged nucleotide in a human…
A: The correct order of enzymes used to fix a damaged nucleotide in a human gene is option d , i.e.,…
Q: escribe the appearance of DNA, spindle fibers and location of the chromosomes ease describe the…
A: BASIC INFORMATION CELL DIVISION It is necessary for all the cells. In this the parent cell divides…
Q: Escherichia coli's chromosome has a replication origin called OriC. Draw a schematic diagram to show…
A:
Q: Replicate, transcribe and translate the DNA strand below. Be sure to label your 5’ and 3’ ends and…
A: DNA has two strand, one strand is actively used as a template in the transcription process, this is…
Q: Long interspersed nuclear elements (LINES) found in eukaryotic genomes
A: Correct Option Transposons that can copy themselves and move around the genome
Q: Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Complementary DNA sequence: mRNA…
A: DNA molecule is the genetic material present in the animals. Genetic material is present in the…
Q: State 3 simple ways in which RNA polymerase is the same as DNA polymerase.
A: A polymerase is an enzyme, which synthesizes long chains of polymers or nucleic acids.…
Q: oDNA THE DOUBLE HELIX -- (modified from The Biology Corner - Worksheets and Lessons) hody in a cell.…
A: DNA stands for deoxyribonucleic acid.DNA made up of nucleotides.DNA consists of deoxyribose sugar…
Q: Template strand: 5'.GTCTCTTGACATTG... 3' if the nucleotide highlighted in yellow is mutated to a C,…
A: A silent mutation is a change of the succession of nucleotide bases which establishes DNA, without a…
Q: Topic: Nucleic Acids (DNA) Explain “the two strands are antiparallel”.
A: DNA is a deoxribonucleic acid which is a complex molecule present in all living cells. It stores…
Q: In eukaryotes, why is less DNA transcribed the more it is compacted
A: Transcription is the molecular process in which the genomic sequences of DNA are transcribed into…
Q: You want to amplify the DNA between the twostretches of sequence shown in Figure Q8–3. Of the…
A: In molecular biology, PCR is used to make multiple copies of (amplify) tiny regions of DNA or a…
Q: Genome Assembly with Perfect Coverage and Repeats Given a list of error-free DNA 3-mers taken from…
A: Bioinformatics: Bioinformatics is an interdisciplinary science that develops methods and software…
expalin Yeast centromeric DNA sequences
Step by step
Solved in 2 steps
- COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGCOrigin of replication [ Choose ] [Choose] Codon Complementary pairs with cytosine in a DNA molecule The site of protein synthesis Ribozyme This molecule can begin the synthesis of a polymer of nucleotides without a primer A short peice of lagging stand DNA Primase A reflection of redundancy in the genetic code RNA which exhibits enzymatic properties Okazaki Fragment The process of making RNA from DNA Helicase DNA polymerase Transcription Enzyme which lays down a segment of RNA on replicating DNA so that DNA nucleotides can polymerize A sequence of three nucletotides which codes for an amino acid Ribosome Point Mutation Chromosome Wobble Position The point on a stand of DNA where replication begins Mitochondria RNA polymerase [ Choose ] GuanineYeast artificial chromosome how the synthesised?
- Re-write the following false statement to make it true: A bacterial replication fork is asymmetrical because it contains two DNA polymerase molecules that are structurally distinct.Structure of DNA double helixENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE
- EcoRI --- 5' G - AATTC 3' 5' AGAATTCCGACGTATTAGAATTCTTAT CCGCCGCCGGAATTCT CATCA 3' 3' TCTTAAGGCTGCATAATCTTAAGAATAGGCGGCGGCCTTAAGAGTAGT 5' Number of pieces of DNA , and type of fragment .ANALYSIS ANALYSIS: A DNA strand undergoes all the process included in the central dogma. The DNA strand used as a template is given below: Parent strand DNA: DNA daughter strand: 5-AGA-ACT-AAA-CТА-ТСG-СTT-CGT-3' hnRNA: MRNA: original protein: mutated mRNA: mutated protein: second letter A G UUUPhe UCU) UCC UAU UGU Cys UUC U UUA UAC Tyr UGC Ser UAA stop UGA stop| A UAG stop UGG Trp UCA Leu UUG UCG G CUU CCU CAU CGU His CAC САА CUC CC CGC Leu Pro Arg A CUA ССА CG CGA Gln CAG SO AAU CUG CGG AUU ACU AGU AGC Ser A Asn AUC lle A AUA ACC AAC Thr AAA AAG Lys GAU АСА AUG Met ACG AGG Arg GUU GCU GGU U Asp GUC GGC GCC GCA GCG GAC Val GUA Ala Gly A GAG Glu GGG GAA GGA GUG G Translating the unmutated MRNA that was obtained after splicing, the original protein sequence will be? The original protein is [A] (For your answer, use the one-letter symbol (all caps) for the amino acid residues separated by dashes, e.g. C-A-S-H). first letter third letterEboV from Guinea pig Reference DNA Sample mRNA Protein
- Paragraph Styles Editing Voice 7. How many hydrogen bonds exist between this DNA strand and its complementary strand? •5'-GAGAGTC-3' Answer: Explanation: Focus 375 words English (United States) 60% Type here to search LenovoReplication. Complete the table by writing the sequence of the complementary strand. Strand 1 3’ END TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ END STRAND 2Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'
