Ligation is an essential step in the cloning process. It refers to the joining of the gene ofinterest to the vector using DNA ligase.(i)Determine FOUR (4) control groups which are important to determine the success ofthis step and also to troubleshoot if any problem should occur.In an experiment, 100 ng vector was added into ligation reaction with 50 ng of insert(500 bp). The desired vector: insert ratio of 1: 3 was used. Determine the size of the(ii)vector.

According to the question, we have to determine the four control groups which are important to…

Answered: Ligation is an essential step in the…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

In a typical microbiology laboratory, reasons for no bands from a gel of a polymerase chain reaction may be due to errors relating to omission of ingredients in the reaction mix and absence of the target sequence in the template DNA. Based on (i) primer problem and (ii) purity/potential contamination of the target sequence, explain the reasons for non-appearance on bands.
In a typical microbiology laboratory, reasons for no bands from a gel of a polymerase chain reaction may bedue to errors relating to omission of ingredients in the reaction mix and absence of the target sequence inthe template DNA. Based on (i) primer problem and (ii) purity/potential contamination of the target sequence, explain the reason for non-appereance on bands.
The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage) is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline. The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giving the patterns shown below. What does each pattern say about the cloned DNA? Note: pBR322, the PstI and EcoRI restriction sites are about 750 bp apart. The entire plasmid with no cloned insert is 4,361 bp. Size markers in lane 4 have the number of nucleotides noted.
With the use of well-illustrated diagrams, reconstruct the entire cloning process by explaining different stages of the cloning process that involves the following: d. Screening/selection of hosts containing the intended recombinant plasmid. For this stage(d), discuss the importance of a second marker that can be used for screening of genomic DNA for colonies containing the pka-1 under the principle of insertional inactivation. This should be properly explained using all the attributes of the plasmid described above.
2) The authors investigate if the switch from the polymerase to the exonuclease site involves releasing and re-binding of the DNA or if it utilizes an intramolecular rearrangement. To accomplish this, they use a primer-extension assay. How is a primer extension assay performed? In answering this question, be sure to mention a.) why heparin is used, b.) how they generate mismatched primers, and c.) how they visualize only the primer strand and not the template strand on their gel.
Describe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are present or (b) an excess of primers is present.
a.) wanting to clone gene Z into pVector, the gene is amplified by PCR and restriction sites are added to the flanking ends. without realizing that the antibotic resistant gen )tetR) had a Sal1 site, you decide to add EcoR1 and Sal1 recofnition sequencen into the 12-nucleotide primers. Write the sequence of the 2 primers, noting the 5' and 3' ends?
1) The DNA fragment shown in Figure 1 is cleaved by the restriction enzyme EcoRI as indicated. The number in parenthesis shows the position of the cleavage site. The total length of the DNA fragment is 4000 bp. Small parts of the DNA sequence is known as shown. 5' ACCCTAGGTGTGACCGCGATCCGGCAGCATAAT 3' EcoRI (400) EcoRI (1300) EcoRI (3800) 3' CGCGAAATGCTTTAAGCGCTCTACGGGAGGG5' 3'AGCGTTAGAGTAGCCGGTAAAGGGTACGCGCCTTAA 5' Figure 1: DNA fragment with a total length of 4000 bp. The figure below depicts a gel on which marker DNA of known size has been run. Sketch the location of the bands that will appear, if the DNA fragment shown in Figure 1 is cleaved by EcoRI and afterwards run on the gel along with the marker DNA. 6000 5000 4000 3000 2000 1000 800 600 500 400 200
The following diagram shows one-half of a restriction site. (a) Draw the other half. GAC G I C (b) Use heavy arrows (↑1) to identify type II cleavage sites that would yield blunt-ended duplex DNA products. (c) Use light arrows (T1) to identify type II cleavage sites yielding staggered cuts that could be converted directly to recombinant DNA molecules by DNA ligase, with no other enzymes involved. (d) If this were the recognition site for a type I restriction endonu- clease, where would cutting of the duplex occur? (e) If DNA sequences were completely random, how large an inter- val (in kilobase pairs) would you expect between identical copies of this sequence in DNA?
Draw roughly the comparative electrophoretic mobilities of close circular DNA, open circular DNA and super coiled DNA, all having the same molecular weight. Describe the process of cloning a DNA fragment into the EcoR1 and AluI sites of the vector pUC18. How would you screen for clones that contain an insert?
#3) Ligase catalyzes a reaction between the 5' phosphate and the 3' hydroxyl groups at the end of DNA molecules. The enzyme calf intestinal phosphatase catalyzes the removal of the 5' phosphate from DNA molecules. What would be the consequence of treating a cloning vector, before ligation, with calf intestinal phosphatase?
You have a 5.3 kb PstI fragment cloned into the PstI site of the vector pUC19, which is 2.7 kb in size. This vector has unique sites for the following enzymes in a multiple cloning site: PstI, HincII, XbaI, BamHI, SmaI, EcoRI A restriction map of the 5.3 kb insert is prepared. The recombinant plasmid is digested with the enzymes listed above in single digests, and then several combinations of enzymes are tested in double digests. The following bands are observed when the digests are run on a gel: Use the data above to construct a map of the cloned insert. Note that fragments smaller than 100 bp will not usually be visible on a gel, and that 2 fragments with a similar size will run at the same spot on a gel – resulting in a brighter band.

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS