Answered: IRE-1 activates the unfolded-protein…

IRE-1 activates the unfolded-protein response because of its ability to directly Cut proteins Cut RNA Synthesize lipids Activate transcription

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 11QP: Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA

See similar textbooks

Related questions

Q: What molecule catalyzes the formation of proteins

A: The protein synthesis process is a process where amino acids are formed by reading the frame of the…

Q: Look at the m-RNA message below: PUT A NUMBER under each of the t-RNA/amino acid complexes to show…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: A protein changes shape only once, and allows many molecules of one type to pass through the…

A: Answer - Option C - A channel

Q: Which amino acids are coded for by the mRNA strand: AUG UCA CGA GGU? methionine, leucine, alanine,…

A: DNA is the genetic material present within the nucleus in the cell. It maintains the heredity of the…

Q: For each amino acid incorporated into a polypeptide the cell has to invest three high-energy…

A: TRANSLATION It is the process by which a protein is synthesized from the information contained in a…

Q: What mRNA is transcribed from each DNA sequen а. 5'-GTTCTАС-3' 3'- -5' b. 5'-ATTTGAAA-3' 3'- -5' с.…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. That copy,…

Q: Polypeptide synthesis proceeds in either direction once initiated. proceeds from the…

A: Peptides are short chains of amino acids that are linked together by means of a peptide bond.…

Q: AKS 5c1: Use the model below to answer the question that follows. Which interpretation of this model…

A: Cell is a structural and functional unit of living organisms. Several cells joined together to form…

Q: Match the following with the correct process. converts DNA into mRNA occurs in the ribosome 1.…

A: All new proteins in the cell are formed by conversion of DNA to amino acids. conversion of DNA to…

Q: Nucleotides - U - T -Sugar & Phosphate - Anticodon - Codon - Ribose - Transcription -…

A: The central dogma consists of DNA to DNA (Replication) DNA to RNA (Transcription) RNA to proteins…

Q: Which part of the ribosome in bacteria, forms the catalytic site for peptide bond formation? A. 16S…

A: Ribosomes are small particles in cytoplasm associated with ER membrane. Ribosome is made up of…

Q: Match each function to the appropriate type of RNA. Messenger RNA (MRNA) Ribosomal RNA (1RNA)…

A: Introduction :- Transcription is the process of synthesis of different types of RNA molecules from…

Q: Write the polypeptide sequence that would be translated from your mRNA sequence.

A: Answer - The DNA sequence will be - 5' CTATAAGGCGCAAATCCCTGCCAT 3' - Non-coding strand 3'…

Q: Where does translation of mRNA into polypeptides occur? a.Cytoplasm b.Nucleus c.Nuclear pores…

A: Cells are the biological, structural and functional unit of an organism. Cell has a nucleus that…

Q: Match the listed possible protein functions to the example of that function from the list.…

A: Proteins play important role in our body as it is known to perform several functions such as it acts…

Q: Information in DNA is carried to the site of protein synthesis by

A: Central dogma is the process by which gentic information of DNA is transferred from DNA to other…

Q: The “zipper” of a leucine zipper protein attaches (a) specific amino acids to specific DNA base…

A: Introduction: Proteins are macromolecules that form when amino acids connect to each other. The bond…

Q: 8. Chaperones is/are useful in: a. Folding of protein b. Release of protein c. Denaturation of…

A: Chaperons are the proteins present in a wide range of species from bacteria to humans . They are…

Q: Which part of the ribosome in bacteria, forms the catalytic site for peptide bond formation? 16S…

A: Gene is a hereditary units which is exhibited on the chromosome . Gene expression is a phenomenon in…

Q: Which amino acid sequence is coded for by the mRNA segment AUG-CCC-CAC-GAA-UAC? Met-Pro-Gin-Asp-STOP…

A: Amino acids are organic compounds that are joined together to form proteins. Amino acids and…

Q: How could RNAi be used medically?

A: The basic structural and functional units of life are cells. Trillions and billions of cells make up…

Q: tRNA is a type of RNA involved in translation. What does it do?

A: RNA (ribonucleic acid) is a biological polymer that carries genetic information in some viruses.…

Q: stimulating

A: The double stranded DNA contain the Nitrogenous bases on the strands . Transcription of the sequence…

Q: A cell is actively undergoing cell signaling. Random cytoplasm samples are taken at 10 ms intervals…

A: Cell signaling is the process of cellular communication within the body driven by cells releasing…

Q: AKS 5c1: Which of the following demonstrates the correct sequence of events that occurs during…

A: The correct sequence of events is given below.

Q: Base on the template strand of DNA: GAT CTC ATA GHC what is the sequence of mRNA that will be…

A: Transcription is part of the Central dogma. In transcription, messenger RNA (mRNA) is transcribed…

Q: Within the cell, some organic molecules can lower the activation energy required for a chemical…

A: Cell is the smallest structural and functional unit of life. It is simple machinery that houses all…

Q: Where does translation of mRNA into polypeptides occur? A. Nuclear pores B. Nucleus C.…

A: The translation is the step in the central dogma where the mRNA obtained from the transcription of…

Q: What is the purpose of unfolded protein response? Steps of unfolded protein response that allow…

A: The unfolded protein response is a cellular stress response related to the endoplasmic reticulum…

Q: How can small interfering RNAS (SİRNAS) and micro RNAS (MİRNAS) regulate gene expression? Prevent…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: Examine figure and determine which components would act asepitopes or antigens.

A: The virus is the infectious agent that consists of a nucleic acid molecule present within a protein…

Q: Yes or no! Does formaldehyde create covalent bonds between 2 proteins and proteins and nucleic…

A: 1 :yes Formaldehyde binds with protein and DNA enable to form methylene bridges and produces…

Q: What sort of molecule would benefit from the action of chaperone proteins? А. GRNA. В. Hydrophobic…

A: The proteins are made up of amino acids that binds together by peptide bonds. Different types of…

Q: The stringent response involves all EXCEPT A) O reduce expression of rRNA genes B) O reduce…

A: Answer is A.) reduce expression of rRNA genes.

Q: NAME THE PROTEIN! It is a Golgi resident enyme It attaches a phosphate group to mannose sugars on…

A: The targetting of lysosomal enzymes are mediated by GERL transport system. The lysosomal enzymes are…

Q: N-linked glycosylation of proteins occur in the ER. The attached oligosaccharides are further…

A: N-linked glycosylation is the specialized process in which an oligosaccharide (a carbohydrate which…

Q: tRNAs carry amino acids bind to the anticodon present in the mRNA adapt the genetic information to…

A: Transfer ribonucleic acid (tRNA) is a type of RNA molecule that helps decode a messenger RNA (mRNA)…

Q: Ligands are extracellular proteins involved in signalling. Explain how a typical ligand is secreted…

A: Ligands The pathway in signal transduction includes the binding of signaling molecules. These…

Q: What is the cellular location of the MC1R protein? nuclear cytoplasmic cell…

A: Cells are the basic and smallest units that make up living organisms. Cells can be classified as…

Q: Which of the following are common ways to regulate a protein? Group of answer options none of the…

A: Regulation of pathways The regulation of the metabolic pathway depends upon supply of nutrients,…

Q: raction wit

A: n signal basic, interacts with importin-alpha signal anchor mostly hydrophobic, interacts with…

Q: Draw a schematic diagram for RNA (a) transcription and (b) translation then label organelles,…

A: A. Transcription is a synthesis of RNA with the help of the template strand of the DNA. B.…

Q: The process illustrated below is: Ribosomes Polypeptides transcription, and it occurs in the cytosol…

A: Polypeptides are small chains of amino acids bound together by peptide bonds. The polypeptide chain…

Q: Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the…

A: Though it is easier to decide the sequence of amino acids from a given segment of either DNA (any…

Q: AUG MRNA 5' 3' ribosome protein |N C signal sequence binding domain ligand binding DNA kinase…

A: For any signalling molecule to start the signaling process they need to binds with their appropriate…

Q: Once a protein’s life span in a eukaryotic cell has hit its limit, how does the cell respond

A: In eukaryotes, as in bacteria, transcriptional regulation is the primary means of controlling gene…

Q: Explain how Nsp1 binds the ribosomal mRNA channel to inhibit translation

A: The SARS-Cov-2 virus is the agent for pandemics that occurred recently. It is an RN virus that…

Q: Messenger RNA is translated into proteins on ribosomes—large molecular complexes assembled from…

A: The process of translation involves protein synthesis from messenger RNA (mRNA).Ribosomes translate…

Q: Looking at the image shown here, which of the following statements DOES NOT correctly match a…

A: The diagram shows a bacterial cell consisting of other cell organelle.

Concept explainers

Immunology

Immunology is the division of science involved with the immune reactions occurring in living organisms. The organisms are accustomed to evolving internal defense mechanisms to evade the invasion of microbial pathogens. Diverse cells are connected with stimulating the immune responses, which produce inhospitable conditions to the microbes prompting their lysis and thus inhibits the multiplication of the pathogens. The immune system can distinguish the pathogens through the aid of cellular intercommunication and launch responses to destroy them.

Question

IRE-1 activates the unfolded-protein response because of its ability to directly

Cut proteins

Cut RNA

Synthesize lipids

Activate transcription

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which describes an enzymatic activity/biochemical function of importin-beta? facilitate release of nuclear proteins after transport through the nuclear pore complex interact with/bind to nuclear localization sequences INLSS) interact with/bind to importin-alpha hydrolyze GTP to GDP + Pi
Which describes an enzymatic activity/biochemical function of importin-beta? O hydrolyze GTP to GDP + Pi interact with/bind to nuclear localization sequences INLSS) interact with/bind to importin-alpha facilitate release of nuclear proteins after transport through the nuclear pore complex
List the order for the production of a protein for export: Protein is processed at the Golgi Apparatus MRNA is translated into amino acid sequence at the ribosome embedded in RER Protein is released from cell via Exocytosis MRNA is transported to the cytoplasm Gene is transcribed into an mRNA molecule within the nucleus
Describe the mechanism by which endoplasmic reticulum vesicles fuse with the Golgi apparatus, with reference to the role of SNARE and Rab proteins
Description of Activity Prevents the repair or synthesis of phospholipids Breaks open bonds between NAM and NAG Binds to some DNA dependent RNA polymerases Inhibits DNA gyrase activity Prevents initiation of active ribosome formation Binds to reverse transcriptase Inhibits integrase activity Prevents synthesis of essential amino acids by blocking a biochemical pathway Prevents viral capsid from being dissociated Prevents biosynthesis of mycolic acids Binds in the A site of an active ribosome complex Prevents aminoacylation of tRNAs Binds to host cell receptors Interferes with RNA dependent RNA polymerase Denatures cytochrome proteins Blocks ATP synthase permease Binds to peplomers Cidal or Static? Narrow or Broad Spectrum? Effective Against Bacteria? Effective Against Viruses?
Explain how Nsp1 binds the ribosomal mRNA channel to inhibit translation
Give an example of the action of a plasma membraneenzyme.
Describe Information Transfer Replicetion. Transcription 9 Tromslation:
Genetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tail
A peripheral protein, which is not integral to the cell membrane, is also called: a multi-pass transmembrane protein (like band 3.0 protein) a single-pass transmembrane protein (like glycophorin A) a monolayer-associated protein (like the COX-1 protein) a protein-attached protein (like cytochrome c) a lipid-linked protein (like the Ras protein)
Please draw or trace a pathway of any protein from translation to the plasma membrane. Name the protein (make sure it is a transemembrane protein). The protein in question must also have seceral protein modifications including, but not limited to, N-linked glycosylation, cysteine disulfide bonds, lipid modifications, and 3-D folding
A eukaryotic region consisting of a combination of enhancer and insulator elements Ribosome Binding Region O Mediator Locus Control Region Insulator Control Region