In this depiction of trascription, the ___ strand is ___ because it ___.   upper; RNA; contains guanine   upper; RNA; has no uracil   lower; DNA; contains adenine   lower; RNA; contains thymine   upper; RNA; contains uracil

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sequence shown above, identify the following: mRNA…

A: A biological process in which the information present in DNA is copied to RNA (mRNA) is known as…

Q: Fill in the chart AND answer the question at the bottom of the page. Answer it accurately and…

A: A mutation is an event where the DNA sequence gets changed as a result different types of sequences…

Q: The Genetic Code * ( Choose True if the statement is correct abourt genetic code and False if…

A: Genetic code consists of nucleotides that code for specific amino acids in protein synthesis. Each…

Q: The nucleoid region is not a specific thing or structure, it is the general area occupied by…

A: On the basis of complexity of DNA and arrangement of DNA and the presence of membrane bound…

Q: Directions: Study the DNA sequence below and answer the questions. Use a separate paper for your…

A: Each organism's DNA sequence is unique. Its base-pair sequence might vary from time to time. It is…

Q: RNA is pretty easy to make into DNA because it's single stranded , doesn't form as many structures,…

A: The first step a cell takes to read out a genetic instruction is to copy a particular nucleotide…

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Which type of chemical bond is responsible for RNA-DNA base pairing during reverse transcription?…

A: The DNA and RNA nucleic acids that is composed of nucleotides. The nucleoitides are made up of…

Q: Put 4 questions on this image with the answer. Thymine Cytosine Adenine Guanine Nucleobases of DNA…

A: Cell is an elemental unit of the body in which numerous cellular processes take place. Cellular…

Q: In the genetic code ______ codons code for amino acids, while _____ are stop codons and do not code…

A: The collection of guidelines known as the genetic code governs how the arrangement of nucleotides…

Q: DNA Sense G C A strand DNA Antisense TAC T strand AUG MRNA codon U TRNA anticodon Amino acid…

A: Transcription Cellular process in which RNA is synthesized using DNA as a template known as…

Q: RNA occurs primarily as single strands and can adopt more compact structures than DNA molecules.…

A: Nucleic acids are molecules that help in storing information to be used for cellular growth as well…

Q: Small nuclear RNA from 50-200 bases that combine with proteins to form complexes capable of editing…

A: RNA editing is a post-transcriptional modification process that alters the sequence of RNA…

Q: Supply the missing information DNA: 3' mRNA: anticodon: amino acids: TAC-CCG-TCG-GGG-CGT-ATA-ACT 5'…

A: Transcription is the process of synthesis of mRNA using one of the strands of the DNA. During this,…

Q: Label the N-terminal and the C-terminal in the above peptide.

A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…

Q: A/An________protein binds to the exposed end of a polymeric molecule preventing further…

A: ANSWER) Carrier protein A/An Carrier protein protein binds to the exposed end of a polymeric…

Q: Exons are nucleotide sequences that contain ________ genetic information   Question 13 options:…

A: A DNA consists of coding and non coding sequences. The coding sequences are the sequences that will…

Q: A strand of DNA containing the repeating sequence TAC GCT TTT GCG ATAACT could code for which of the…

A: When DNA is converted into RNA then this is called transcription.  When mRNA encodes protein then…

Q: Some aminoacyl-tRNA molecules bind to more than one codon because there is some play or wobble in…

A: An aminoacyl-tRNA molecule, often referred to simply as charged tRNA, it is a key player in protein…

Q: The nucleotide is adenine adenosine adenosine monophosphate cytidine prion

A: A nucleotide is the basic building block of nucleic acids like RNA and DNA. The nucleic acids act as…

Q: Eukaryotic RNAs, such as tRNA and rRNA use different RNA Polymerases.   True False

A: Eukaryotic transcription:- In Eukaryotes, 3 different  kind of RNA polymerase are used.

Q: RNA means: Ribonucleus Alkaline Ribonucleus Alum Ribonucleic Acid Ribonucleus Acid

A: RNA:  It is a polymeric molecule which is responsible for various biological roles such as…

Q: DNA RNA No Answers Chosen No Answers Chosen Both No Answers Chosen Possible answers | Major and…

A: Transcription is the process in which a gene sequence is used to make the RNA. Translation is the…

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…

Q: Binding domain refers to: O functional region of the protein O DNA sequence the protein binds to

A: The binding domain refers to a functional region of the protein.

Q: Sequence: AAA UGG CAA   Is the sequence RNA or DNA? How do you know?   Question 1 options:   You…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Please help me explain this on my report on cell dogma

A: Molecular biology deals with cellular molecules' structural, composition, and interactions such as…

Q: 5′ capping is the first step in ________ processing.

A: Eukaryotic mRNA precursors are handled by 5′ capping, 3′ cleavage and polyadenylation, and RNA…

Q: Which of the following stretches of RNA is most likely to form a hairpin with 4 bases making up the…

A: A nucleotide (pentose sugar + nitrogenous base + phosphate group) is a phosphoric acid ester of a…

Q: Short tandem repeats are locations in our DNA that have repeating nucleotide sequences. Group of…

A: Most of the DNA of the eukaryotic cells obtains a single main band in the sedimentation equilibrium…

Q: What is the: 1. Complementary strand & mRNA sequence 2. Amino acid sequence 3. Identify the…

A: What is the: 1. Complementary strand & mRNA sequence    3' -TAC- CAG -GTT -ACC -AGT- 5'…

Q: Compare the structure, location, and function of DNA and RNA in a chart below

A: DNA is a is normally been described that it's far the molecule this is decided withinside the…

Q: figured out that the protein sequence was:   Met-Ala-Arg-Gly-Trp-Ala-Pro   Work backwards…

A: In this process first of all RNA sequence could be find out by the genetic code. Later on  sequences…

Q: What nitrogenous base is considered to be damage if found in DNA?       Adenine   Thymine…

A: The integrity of DNA is crucial for the accurate transmission of genetic information during cell…

Q: A type of protein that associate with DNA, in Eukaryotes cell to compact the protein is Histamine.…

A: Introduction:- Watson and Crick suggested the DNA structure. They claim that DNA is a double-helical…

Q: The part of a eukaryotic cell that produces secondary, tertiary, and quantenary proteins are ______.

A: Introduction: Ribosomes are complex molecular machines that are found in all living cells, including…

Q: Translate to amino acids the strand using the Genetic Code chart. Remember to use the start and stop…

A: mRNA or messenger RNA contain the genetic codons that must be translated into amino acid chain…

Q: A ________ is a recognizable folding pattern involving at least 2 secondary structures and the…

A: Proteins are primarily synthesized as a linear chain of amino acids linked together via peptide…

Q: A/An ___ is one of the 13 linear polymers of tubulin subunits that forms a microtubule.

A: The cytoskeleton is made up primarily of microtubules. They are found in all eukaryotic cells and…

Q: DNA RNA Type of sugar Number of strands Nitrogenous bases Location Function Helix (Yes or No)…

A: DNA and RNA are called nucleic acids which are made up of the basic units called nucleotides. A…

Q: The __________ strand is read by RNA polymerase. The __________ strand is identical to the…

A: The theory of central dogma states that genetic information flows only in one direction, from DNA,…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.