In this depiction of trascription, the ___ strand is ___ because it ___.   upper; RNA; contains guanine   upper; RNA; has no uracil   lower; DNA; contains adenine   lower; RNA; contains thymine   upper; RNA; contains uracil

Q: The nucleoid region is not a specific thing or structure, it is the general area occupied by…

A: On the basis of complexity of DNA and arrangement of DNA and the presence of membrane bound…

Q: If I'm any organism a dna molecule is 24% cytosine, how much adenine will that dna molocule contia

A: The rules of Chargaff are significant because they refer to a kind of "biological grammar," or a…

Q: RNA is pretty easy to make into DNA because it's single stranded , doesn't form as many structures,…

A: The first step a cell takes to read out a genetic instruction is to copy a particular nucleotide…

Q: Mutation a change in the DNA Point mutations - when a single nitrogen base is deleted, inserted or…

A: The key information we need for understanding mutation is the specific base pairings. The specific…

Q: Write TRUE/FALSE in number 6,7,8,9,10 ____6. “ Prokaryotic ribosomes is made of 40S and 60S…

A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…

Q: ______ mutations in the coding sequences of a gene maymodify the amino acid sequence of the…

A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…

Q: If one nucleotide is randomly changed in a DNA sequence, that is an example of ___ mutation

A: To answer this question we should have knowledge of biochemistry.

Q: What is the amino acid sequence of the peptide that would be synthesized after transcription and…

A: In this situation, we are entrusted with figuring out the amino acid sequence of the peptide…

Q: Evaluating: If a DNA strand reads AATGCTCCAGT, what would the complementary strand read: * O…

A:

Q: Answer the following questions based on the given the sequence of nucleotides in a DNA molecule…

A: Given:- The sequence of nucleotides in a DNA molecule:- 5'…

Q: Put 4 questions on this image with the answer. Thymine Cytosine Adenine Guanine Nucleobases of DNA…

A: Cell is an elemental unit of the body in which numerous cellular processes take place. Cellular…

Q: Holoenzyme binds the DNA without the assistance of proteins such as TFs. True  False

A: Enzymes are the catalysts who function to enhance the rate of reaction without the enzymes being…

Q: Whole DNA chromosomes are kept in the nucleus while small nucleotide monomers move into and out of…

A:

Q: Determine the characteristics of this piece of double-stranded DNA.   GTCTTTTACTTGAAT…

A: DNA is the double helical structure that contains the information that help in inheritance. The…

Q: Some aminoacyl-tRNA molecules bind to more than one codon because there is some play or wobble in…

A: An aminoacyl-tRNA molecule, often referred to simply as charged tRNA, it is a key player in protein…

Q: The point where separation of the DNA occurs is called the Stranding point True False

A: DNA replication is a biological process through which a single DNA molecule is used to produce two…

Q: RNAi is produced when                Question 26 options:     a single-stranded DNA shares the…

A: RNA interference (also called “RNA-mediated interference”) is a mecha­nism for RNA-guided regulation…

Q: The sugar of the nucleotide provides the energy to link two nucleotides together.

A: DNA is the polymer of nucleotides.

Q: Eukaryotic RNAs, such as tRNA and rRNA use different RNA Polymerases.   True False

A: Eukaryotic transcription:- In Eukaryotes, 3 different  kind of RNA polymerase are used.

Q: for pa... Lightspeed System. rest up manny il Quiz | ReadTheory photo ONA/RNA Quiz #1 tarted: Feb 2…

A: The monomers of DNA are called nucleotides . Nucleotides have three components. answer is…

Q: DNA RNA No Answers Chosen No Answers Chosen Both No Answers Chosen Possible answers | Major and…

A: Transcription is the process in which a gene sequence is used to make the RNA. Translation is the…

Q: Below is a short segment of DNA molecule. transcribed the DNA codon into mRNA.…

A: Convertion of TACCATGAGAATTGTGGTCACCTTTTT ATGGTACTCTTAACACCAGTGGAAAAA to mRNA is done and results…

Q: DNA reacts with Biuret through ______________, and shows an absorbance in the visual region at…

A: DNA is also known as deoxyribonucleotide. DNA has double-stranded having two antiparallel strands…

Q: Cis-elements such as Response Elements found in DNA and are bound by proteins are usually ________ .…

A: Transcription is a process of formation of transcript or RNA from DNA by the process of…

Q: By convention, nucleotide sequences are always written from the _____.

A:

Q: Binding domain refers to: O functional region of the protein O DNA sequence the protein binds to

A: The binding domain refers to a functional region of the protein.

Q: most STR fragments used in human forensic analysis are comprised of_____ repeats

A: STR Stands for short tandem repeats, these are short sequences in DNA that make large subunits…

Q: Please help me explain this on my report on cell dogma

A: Molecular biology deals with cellular molecules' structural, composition, and interactions such as…

Q: Fill in the palindromic sequence of the given DNA strand containing six bases. 5' GACGTC 3' 3' _ _…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: ALL GROUPS HAVE A MUTATION MAKE SURE TO IDENTIFY THEM**

A: A mutation is a change in a DNA sequence. It can result from DNA copying errors made during cell…

Q: It asks to categorize the possible answers to a component of eukrayotic RNA, eukrayotic DNA or both:

A: DNA and RNA are both the genetic material that expresses the heredity characteristics from…

Q: GIVEN:  DNA CODING STRAND: GCG TAC TTT TCA GGT DNA TEMPLATE STRAND ____ ____ ____ ____

A:

Q: What is the: 1. Complementary strand & mRNA sequence 2. Amino acid sequence 3. Identify the…

A: What is the: 1. Complementary strand & mRNA sequence    3' -TAC- CAG -GTT -ACC -AGT- 5'…

Q: A virus has a double-stranded RNA genome that has 2400 base-pairs. Of these, 35 % are G:C…

A:

Q: Contains nitrogenous base and pentose sugar v One copy of all chromosqmes in cell DNA Nucleotide…

A: a)Nucleotide: Contains nitrogenous base, pentose, and phosphate

Q: Crick and Watson, whose work greatly contributed to the discovery of the double helical structure of…

A: Made by Rosalind Franklin utilizing a procedure called X-beam crystallography, it uncovered the…

Q: A/An ___ is one of the 13 linear polymers of tubulin subunits that forms a microtubule.

A: The cytoskeleton is made up primarily of microtubules. They are found in all eukaryotic cells and…

Q: None

A: Making an RNA strand that is complementary to the DNA template strand is called Transcription. Note:…

Q: Question S end shoephete adre GLare H H oyaene Pyimdine bemes HO OH a. Label the strands as being…

A: Biomolecules also known as biological molecule is any of the numerous substances that are produced…

Q: Sequence the following structures from smallest to largest nucleus chromosome %3D %3D gene DNA…

A: The cell is considered as the basic building block that helps to build the organism as a whole.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.