In Sickle Cell Anemia, the production of both of the A and S beta-globin peptides in carriers suggests that the Hb beta^A and the Hb beta ^S genes^1 dominance relation is… A) Hb beta A is dominant B) Hb beta S is dominant C) Hb beta A and Hb beta S are codominant D) Hb beta A and Hb beta S are incompletely dominant

In a particular species, the gene for the kappa light chain has 200 V segments and 4 J segments. In the gene for the lambda light chain, this species has 300 V segments and 6 J segments. If only the antibody diversity arising from somatic recombination is taken into consideration, how many different types of light chains are possible?

Talk about the challenges involved in determining the genetic components of polygenic illnesses.   Explain complementation groups and how the biochemical underpinnings of disease are determined using them.   Hereditary illnesses of genomic instability include Werner syndrome, Bloom syndrome, XP, ataxia-telangiectasia, and Fanconi anemia. Which of these ailments has molecular mechanisms behind it? Which kind of genetic instability is connected to which disorder?.

A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…

How can a single nucleotide insertion in the beta globin gene generate a phenotypic change in the ability of the red blood cell to transport oxygen?

Examine the karyotypes of Jacob and PAtau syndromes. List the similarities and differences between these two syndromes. which is more severe?

In squirrels, individuals that are heterozygous for the mutant LDL receptor gene( Fa) begin to experience heart attacks at the squirrel equivalent of the 30’s and 40’s in humans, while individuals that are homozygous for the mutant LDL receptor allele experience heart attacks much earlier. Closer examination reveals that the hepatocytes of the homozygous normal squirrels contain ONLY normal receptors. In the hepatocytes of the heterozygous squirrels, 50% of the receptors are of the mutant type, and fail to bind the LDL cholesterol, while the other 50% are normal. In individuals homozygous for the mutant LDL receptor allele, only mutant receptors are present.   NAME and DEFINE the genetic phenomenon observed here.

How are the genes in the beta-globin locus different from each other? A) They have different evolutionary origins, from different ancestral genes. B) They have different sequences and locations on the chromosome. (C) They are expressed at different times in developmnent. (D) Some are expressed in all cells; some are expressed only in red blood cells. E) They are dispersed on on different chromosomes.