Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
This is a popular solution
Trending nowThis is a popular solution!
Step by stepSolved in 2 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- detail explaination asaparrow_forwarddont provide handwriting solution ...arrow_forwardAs this is a non-directional cloning, recombinant plasmids can contain an insert ligated into the vector in two different orientations. Provide 2 diagrams to illustrate the 2 potential recombinant plasmids, with the inserts ligated in opposite orientations. Include all RE sites and distances between sites on the diagram.arrow_forward
- Below is a plasmid with restriction sites for Baml and EcoRI, Several restriction digests were done using these two enzymes either alone or in combination. Hint: Begin by determining the number and size of the fragments produced with each enzyme. "kb" stands for kilobases, or thousands of base pairs. Plasmid Gel lanes I | III IV V 6 Kb Bam HI Bam HI. 20 Kb PGEN101 (20 Kb) 2 Kb 11 Kb Bam HI 8 Kb 8 Kb 4 Kb 6 Kb Eco RI 3 Kb 21. Which lane shows a digest with BamHl only? a. I b.I c. II d. IV e. V 22. Which lane shows a digest with EcoRLonly? a. I 23. Which lane shows the fragments produced when the plasmid was incubated with both EcoRI and BamH1? a. I b.I c. II d. IV e. V b. I c. II d. IV e. V Base pairsarrow_forwardClone number in this case is number 196 as shown in the images. What is the exact length of the segment of human DNA that has been inserted into the plasmid? *report the entire length of the insert, not just the sequences matching the ends and labels of wells isn't needed for answer*arrow_forwardPrimers designing for epitope tagging: Design forward and reverse primers to amplify the following gene with 6×HIS-tag on the N-terminus of the protein. To be cleaved and inserted into the plasmid, add restriction sites for EcoRI and HindIII at 5' and 3'. ATGCTCTCCGCCCTCGCCCGGCCTGTCAGCGCTGCTCTCCGCCGCAGCTTCAGCACCTCAGCC CAGAACAATGCTAAAGTAGCTGTGCTAGGGGCCTCTGGAGGCATCGGGCAGCCACTTTCAC TTCTCCTGAAGAACAGCCCCTTGGTGAGCCGCCTGACCCTCTATGATATCGCGCACACACCC GGAGTGGCCGCAGATCTGAGCCACATCGAGACCAAAGCCGCTGTGAAAGGCTACCTCGGAC CTGAACAGCTGCCTGACTGCCTGAAAGGTTGTGATGTGTAAarrow_forward
- The plasmid cloning vector pBR322 is cleaved with the restriction endonuclease PstI. An isolated DNA fragment from a eukaryotic genome (also produced by PstI cleavage) is added to the prepared vector and ligated. The mixture of ligated DNAs is then used to transform bacteria, and plasmid-containing bacteria are selected by growth in the presence of tetracycline. The cloned DNA fragment is 1,000 bp long and has an EcoRI site 250 bp from one end. Three different recombinant plasmids are cleaved with EcoRI and analyzed by gel electrophoresis, giving the patterns shown below. What does each pattern say about the cloned DNA? Note: pBR322, the PstI and EcoRI restriction sites are about 750 bp apart. The entire plasmid with no cloned insert is 4,361 bp. Size markers in lane 4 have the number of nucleotides noted.arrow_forwardClone number in this case is number 196 which is shown in the images. State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the human DNA with the plasmid vector band sizes are shown in one of the images. (0.5, 1, 2, 3, 4, 5, 6, 8, 10kb)arrow_forwardAn optimum ligation reaction should contain approximately 50 ng of vector. Given yourconcentrations recorded below, what is the volume of vector that should be added to eachligation reaction to have this mass of DNA in the reaction? Size of asPink-promoterless in bp: 702 (vector) Size of pCusC in bp: 157 The concentration of digested & purified PCR insert: 13.849 The concentration of digested and purified plasmid: 6.887 Any help with this is appreciated. I'm a bit confused thxarrow_forward
- The restricition EcoRI cleaves double-stranded DNA at the sequence 5'-GAATTC-3' the restriction enzyme Hindll cleaves at the sequence 5'-AAGCTT-3'. A 20 kb circular plasmid containing OFP gene is digested with each enzyme individually and then in combination, and the resulting fragment sizes are determined using electrophoresis Restriction Enzyme(s) ECORI alone Fragment length 6 kb ,14 kb 7 kb , 13 kb 2kb, 4kb, 5 kb, 9kb Hindlll alone EcoRI and Hindll Construct the circular molecule and indicate the relative positions of the EcoRI and Hindlll restriction sitesarrow_forwardDo virtual restriction digests of 300ng pGLO plasmid using HinDIII, EcoRI, and XhoI separately, and a double digest of pGLO with HinDIII plus EcoRI. How many nanograms of DNA should we expect to be contained within the slowest bandfrom the HinDIII-digest of pGLO?arrow_forwardPlease both partsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education