In bacteria, which sequences in the promoter does sigma protein recognize to establish a constant position with respect to the start of transcription? -30 and -60 -10 and -60 -10 and -35 -35 and -60

Which of the following is a property or characteristic of eukaryotic promoters? They contain the -10 and-35 consensus sequences where RNA polymerase holoenzyme, containing the sigma factor, bind to initiate transcription. | They contain the -10 and -35 consensus sequences that are the site where general transcription factors bind to help RNA polymerase holoenzyme initiate transcription. They contain a TATA box to which sigma factors bind to help RNA polymerase core enzyme initiate transcription. O I. They are usually located far away from the gene that is being transcribed. IV. OV. A, They are bound by general transcription factors, which help RNA polymerase I, II, or III, bind to the promoter and initiate transcription.

The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?

Using the transcription unit diagrammed below, in which exons are represented by blue boxes and introns are represented by the connecting lines.  You discover a single base deletion in region E of this DNA sequence. Regarding transcription, this mutation will likely: 1.) Result in an alteration to the mRNA sequence. 2.)Have no effect on transcription or the mRNA sequence 3.)Prevent transcription at the TATAA box 4.) Result in an increase or decrease in the amount of mRNA transcribed