Q: Describe what two reaction steps are required for the formation of an aminoacyl-tRNA?
A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that is essential for the production of…
Q: 21) Morgan's fruit fly work showed that genes are made of DNA True False 22) Some genes can…
A: Question : True or False 21) Morgan's fruit fly work showed that genes are made of DNA True False…
Q: pMdawn is digested with EcoR1, and BamHI. Resulting in fragments shown below: EcoRI: 20 kb BamHI:…
A: Plasmids are double-stranded circular DNA found in bacteria. These contain genes related to…
Q: A generalized transduction e xperiment uses a metE+ pyrD+ strain as donor and metE - pyrD- as…
A: Many different chromosomal markers will be transduced in generalized transduction, allowing you to…
Q: Morgan and colleges were ultimately able to identify 4 linkage maps in fruit flies. How many pairs…
A: Morgan studied linkage in Drosophila melanogaster in detail and noticed that flies often showed…
Q: What are the most common childhood cancers, and how do they differ from adult cancers?
A: Worldwide, cancer has emerged as a leading cause of illness and mortality. An improper cell cycle…
Q: The corpora cavernosa is a spongy erectile tissue in the
A: The reproduction process in humans is the Sexual Reproduction. In this, the female gamete and and…
Q: In this experiment, thearubigins were studied for their ability to inhibit the activity of amylase.…
A: Here i discuss about the questions regarding the experiment to check the amylase activity.
Q: help produce food and medicines fix nitrogen decompose and break down waste maintain genetic…
A: Select all of the ways that prokaryotes are important for human and ecosystems?
Q: Population Estimates of Animals in Africa in 1990 and in 2000 1990 2000 Lions Cheetahs Zebras…
A: A population is a collection of members of the same species who coexist in a particular area and…
Q: Why is staining a specimen helpful for microbiologists? This is only done for laboratory decoration,…
A: Why is staining a specimen helpful for microbiologist?
Q: Describe the term SDS-PAGE.
A: Charged particles migrate during electrophoresis under the influence of an electric current. For…
Q: Ore.learn.edgenuity.com/player/ The Nervous System Practice Active Cell, membranes Mark this and…
A: Motor neuron carries impulses to effector and it produce responses.
Q: Sketch scrotum and outline each part with explanation.
A: The scrotum is a skin pouch that hangs from the body between the legs at the front of the pelvis. It…
Q: Area A Area B The figure above shows an airplane view of two protected areas A and B. Which area is…
A: Introduction The goal of conservation biology is to safeguard species, their habitats, and…
Q: This assignment was tricky and I had a hard time figuring it out you place 3 bags each containing…
A: 1) The bag contains 20% sucrose solution and there are three beaker with solutions of different…
Q: Distinguish between mutations in somatic cells versus in germ cells.
A: A mutation is a alteration in the sequence of DNA of an organism. Mutations are caused by…
Q: What channels are open at 3 if this was recorded on the axon of a sensory neuron? K+…
A: The presented diagram is of a typical action potential which happens due to rise and fall of…
Q: Describe What is the function of the anticodon of a tRNAZ
A: The biological instruction manual known as DNA, sometimes called deoxyribonucleic acid, provides…
Q: Temperature differences between seasons can be beneficial to the organisms in lakes and ponds which…
A: One of the key factors affecting freshwater biological systems is temperature. It has a significant…
Q: What special kind of nucleotide is used in the Sanger sequencing procedure?
A: All life is dependent on DNA. It contributes to the genetic code for life and its activities,…
Q: Microorganism: Dinophysis sp Is this organism aerobe or anaerobe? What type would it be? Explain…
A: Introduction: An aerobic organism, also known as an aerobe, is one that can survive and grow in an…
Q: Virgin female Drosophila melanogaster are used in genetic studies because they can store male…
A: The majority of insects breed oviparously, or by depositing eggs. In a pair of ovaries, the female…
Q: 2. Explain about Stroke culture?
A: Culture media contains all the elements which the bacteria needs for growth and is not selective in…
Q: The following can be found in the renal cortex except collecting tubules Bowman's capsule nephron
A: The kidneys are bean-shaped excretory organs and it is the main organs of the urinary system as it…
Q: Arrange the following stages in sequence: 1) postsynaptic cell reacts to the signal 2) action…
A: Nerve conduction in synapse: The synapse is the gap in between two neurons when an action potential…
Q: What is shoot senescence? What Changes Occur during shoot Senescence? what Structural changes…
A: Senescence is the process of cellular aging. It is characterized by a decrease in cell proliferation…
Q: 1) All pea plant traits are "either or" True or False 2) Transcription factors always function by…
A: 1. Mendel studied seven pairs of contrasting characters or traits in pea plants. These are - plant…
Q: Why do algae/plankton not have a gram requirement?
A: Most of the bacteria are primarily identified from their Gram-reaction. These bacteria when stained…
Q: 1. What is the oxygen requirement of sporothrix schenckii? 2. What is the gram reaction of…
A: Introduction : Sporothrix schenckii is a widespread fungus found around the globe. Conditions that…
Q: Which two factors can both cause a population to increase? birth rate and emigration birth rate and…
A: The collection of all the individuals of a same species in a particular area at a particular time is…
Q: What is the correct family of the bacteria image below? (Bases on what was presented in the Lecture…
A: Introduction: Small, single-celled organisms called bacteria exist. Nearly all areas of the world…
Q: 1. Name kind of Major cell morphologies In bacteria?
A: Cell morphology denotes the size as well as shape of the cell. Bacterial cells can be of different…
Q: The cross AaBb x AAbb results in which of the following phenotypic ratios? 1:2:1 1:1:1:1 9:3:3:1…
A: A dihybrid cross is made up of two people who have two features that are regulated by two different…
Q: Given the active site diagram and reaction mechanism, indicate the mechanism of irreversible…
A: The given example is an uncompetitive inhibition. It is also known as anti-competitive inhibition.…
Q: What are the ecological and economical importance of fungi, name five fungal species for each…
A: Introduction Fungi is a kind of microorganism which comes under the kindom fungi. They are…
Q: * 191 Biology B CR-Edgenuity X pre.learn.edgenuity.com/player/ The Nervous System Practice Active 3…
A: Atfirst nerve impulse arrives at presynaptic terminal of one neuron. Then neurotransmitter…
Q: Physiological systems can only tolerate small fluctuations in salt and water concentrations.
A: Four important physiological systems of the human body include the skeletal system, digestive…
Q: - Describe what is happening in figures 1-3. Is the population of mice different in figure 3 than in…
A: Natural selection natural selection is a process by which only the organism that adapts to the…
Q: Define the term "bacterial motility." 2. Discuss the significance of bacterial motility in clinical…
A: Bacteria are small, single-celled organisms that can cause a wide range of infections. Some types of…
Q: what is gel electrophoresis
A: Question : What is Gel electrophoresis,?
Q: How do the pesticide and antibiotic resistance affect the genetic diversity of aquatic species
A: Genetic diversity represents the variations of a trait in natural populations.
Q: Which of the following statements about polynucleotide formation is correct? As a polymer, DNA is…
A: Polynucleotides are made when a polymerase enzyme joins nucleotifes together.
Q: Aquaporins are more concentrated in the descending limb of the loop of Henle.
A: Aquaporin1 is present in apical and basolateral face of proximal convulated tubules and in the…
Q: Answer codon usage based on this description: You have isolated a new eukaryotic microorganism and…
A: Codons It refers to the sequence of three consecutive nucleotides that are present in the DNA or RNA…
Q: 18) In what way is RNA polymerase different than DNA polymerase? RNA polymerase takes part in…
A: Introduction:- Transcription, which produces RNA from DNA, Protein, which gives an organism its…
Q: minant traits, and the other mate carries two recessive traits. After 25 years, the population is…
A: The alleles for linked genes do not segregate during gamete production if two traits are closely…
Q: What inheritance pattern results from alleles with incomplete dominance? The recessive…
A: Incomplete dominance is a one type of Gene interaction, in which both alleles of a gene at a locus…
Q: Explain the basis for identification using biochemical testing. – Again, discuss enzymatic pathways,…
A: Enzymes are proteins that catalyze chemical reactions in the cell. Enzymes are essential for many…
Q: 4. In the food chain on the right, which organism is the tertiary consumer? 5. What is the…
A: Since you've asked multiple questions, we're only answering the first three for you. If you want any…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
7)
In a bacterial species with a "lac operon", the repressor protein will be bound to DNA when lactose is available to the bacterium
True
False
Step by step
Solved in 2 steps
- 26) If there is no lactose present in the cell of a bacterium with a "lac operon" the repressor protein will be bound to DNA True FalseThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′O The lac operon in E.coli encodes enzymes necessary for the breakdown of lactose. For each enzyme (lac Z and lac Y), indicate with a + or-whether or not it is made when there is no lactose or when there is lactose. B-galactosidase (lac Z) No Lactose Permease (lac Y) Lactose Lactose No Lactose Genotype PP0 Z Y/I P*O*Z•Y* I'POCZ Y*/I P* O©Z*Y° P O Z'Y/I P'OʻZ'Y* PP O ZY*/IP*O*Z*Y* IP OCZ Y /I P*O*Z•Y* IPO ZY*/I* P*O©Z*Y• I'PO*Z Y*/IP'O*Z*Y°
- A researcher was trying to determine whether two molecules(A nd B) were corepressors or inducers in their respective operon systems. Data was collected regarding the levels of protein and the amount of gene transcription for the genes in theri respectiver operons. The data is shown below. Level of protein Transcription of gene 1 low Transcription of gene 2 Molecule A High low Low high high Molecule B High high high Low low lowWhat are the effects of the following conditions on Lac operon of bacteria? Do not forget to mention about the role of repressor, activator, RNA polymerase in each case! Glucose is absent and lactose is present Glucose is present and lactose is present Glucose is present and lactose is absentWhich of the following lac operon genotypes would allow for functional versions of all the structural enzymes of the lac operon to be expressed constitutively even in the absence of lactose? Group of answer choices I+ O+ Z+ Y+ A+ I- O+ Z- Y- A- I+ OC Z+ Y+ A+ IS O+ Z+ Y+ A+ I+ O+ Z- Y+ A+
- When referring to attenuation in the regulation of the trp operon it would be safe to say that, when there are high levels of tryptophan available to the organism, ________. tryptophan inactivates the repressor protein translation termination of the trp operon is likely the trp operon is transcribed at relatively high levels the ribosomes stall during translation of the attenuator region transcription termination at the attenuator region is likelyabout components of the lac operon. lac operon B: allolactose upon induction C: Lacl lacZ lacY lacA D: operator A: structural genes E: CAP MacBook Air DD F9 D00 O00 F8 80 F7 F6 F5 F4 F3Suppose that E. coli sustains a mutation in its gene for the lac operon repressor making the repressor ineffective. How would this mutation affect the bacterium's ability to catabolize lactose? Would the mutant strain have an advantage over the wild-type strain? Explain your answer. (Minimum 150 words, the document will be checked for plagiarism)
- 5' 3' ORF1 ORF2 ORF3 ORF4 ORF5 1. Above are pictured 2 operons, one that includes ORF1 and OFR2 and is transcribed using the top DNA strand as the template, and the other includes ORF3, ORF4, and ORF5 and is transcribed using the bottom DNA strand as the template. 3' 5' a) Complete this diagram by using arrows (4) to indicate the position and direction of the promoter(s). It doesn't matter if you draw the arrows above or below the ORFS as long as they are pointing the right way. b) Underline and label with "RBS" the ribosome binding site(s). c) How many different RNA molecules will be made from this region of DNA? d) How many different proteins will be made from this region of DNA? e) How many promoters are found in this region of DNA? f) How many stop codons are found in this region of DNA? g) What assay would you use to investigate the protein accumulation of these ORFs?The organization and function of the lac operon in E. coli is shown in the following figures: XXI Transcription Repressor mRNA Translation RNA polymerase M M Flask ZYA XXXX Active M-repressor protein Repressor active, operon off. The repressor protein binds with the operator, preventing transcription from the operon. (a) An inducible operon Copyright © 2007 Pearson Education, Inc., publishing as Benjamin Cummings Allolactose (inducer) Carbon/Energy Source 0 Z MInactive repressor protein (a) An inducible operon Transcription Translation XXX Permease B-Galactosidase Transacetylase Operon mRNA 3 Repressor inactive, operon on. When the inducer allolactose binds to the repressor protein, the inactivated repressor can no longer block transcription. The structural genes are transcribed, ultimately resulting in the production of the enzymes needed for lactose catabolism. Copyright © 2007 Pearson Education, Inc., publishing as Benjamin Cummings Suppose you inoculate three flasks of minimal…1) A. What is the difference between a repressible vs, an inducible operon? B. Using diagrams and words, describe how the Lac Operon is regulated by different levels of lactose and glucose. Be sure to show what’s happening at the molecular level, including the roles of lactose, glucose the repressor protein, cAMP and CAP.