Answered: if two genes are linked ____ A. they…

Name: if two genes are linked ____A. they are on different chromosomesB. th
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: if two genes are linked ____A. they are on different chromosomesB. they assort independentlyC. they code for the same proteinD. they are on the same chromosome

Science

Biology

if two genes are linked ____ A. they are on different chromosomes B. they assort independently C. they code for the same protein D. they are on the same chromosome

Nutrition Now

8th Edition

ISBN:9781337415408

Author:Brown

Publisher:Brown

Chapter26: Nutrient–gene Interactions In Health And Disease

Section: Chapter Questions

Problem 11RQ

See similar textbooks

Similar questions

The number of Chromosomes in the human gene is ___.
DNA Typing U S₁ S₂ U S₁ S₂ U S₁ S₂ U S₁ S₂ 0000 Locus 2 Locus 3 Locus 1 U S₁ S₂ 1. In Figure 1.16, blood samples are taken from a gate (U), an injured woman (S₁), and her former husband (S₂). The woman claimed that she was attacked by her former husband. The man had a cut on his hand, which he explained as a cut from a broken water glass. Is the unknown sample from her wound, from her former husband, or from an unknown third person? Locus 1 U S₁ S₂ Locus 2 U S₁ S₂ Locus 4 Locus 3 U S₁ S₂ FIGURE 1.16 Locus 4 FIGURE 1.17 2. From the same case, a second blood sample was collected from a stain on the floor of the former husband's home (Figure 1.17). Is this stain from the woman, her former husband, or an unknown third person?
The Xb locus on Alouatta genus, the howler monkey X chromosome has 2 alleles, b+ and b. The b+ allele causes the presence of the Xb surface protein on their granulocyte cells, while the recessive allele b which does not allow the antigen to appear. The Xb locus is at 15 centimorgans, from the GRG locus. The GRG locus produces a normal enzyme activity. Individual howler monkeys with one form of an eye condition have the grg/grg genotype, with the males grg/Y presenting the condition. A male howler monkey with the eye condition caused by this enzyme mutation and no Xb antigen has a normal female howler monkey daughter with Xb antigen. This howler monkey female daughter is expecting a little howler monkey from the mating from a male howler monkey from a different tree. A) Determine the genotype of the howler monkey daughter, from the problem. B) Determine the types and percentages of each gametes in oogenesis produced of the howler monkey daughter female, based on the map distance given.…
Determining Gene Order 1. We want to map the distance between genes E (tall height), B (blue flower color), and G (thick stalk). Each geen has a recessive allele (e= short, b= white and g= thin). (The actual configuration of the Trihybrid will be deduces as a part of the process) A. Your testcross genotypes will be (use slash notation). Female: ______ Male:______ Based on these results, are the genes linked or not? _______
If one nucleotide is randomly changed in a DNA sequence, that is an example of ___ mutation
A reciprocal translocation between chromosomes9 and __ contributes to chronic myelogenous leukemia.
For genes that are close together, the frequencies ofcotransformation or cotransduction are inversely relatedto the distance between the ___
Nullisomy is a genome mutation where a pair of homologous chromosomes that would normally be present is ______.
THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes for first eight amino acids of the ß chain of hemoglobin. The ß chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. mone formed DNA Template Strand: 3'CACGTGGACTGAGGACTCCTC5' 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 4. What amino acids will this mRNA code for? 3. What mRNA will be formed from the template strand of DNA? 5. If the 17th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is this? 67
In Anopheline mosquitoes an inversion associated with resistance to desiccation involves the centromere. These inversions are _______.
Im having trouble answering this question. What type of cells can be altered by GETs like CRISPR and what types of cells cannot and why is this so?
Position-effect variegation occurs when a ___________---rearrangement places a gene next to the heterochromaticregion near the centromere.