Answered: If the nucleotide at position 23 in thw…

If the nucleotide at position 23 in thw first strand of DNA ia changed to "A", what effect would this have on the protein produced?

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein…

A: Introduction A mutation is a change in the structure of a gene, which is the fundamental unit of…

Q: Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna…

A: In molecular biology, the process of protein synthesis involves the conversion of genetic…

Q: Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…

A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…

Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…

A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…

Q: Do any strands of nucleic acid exist in nature in which part of the strand is DNA and another part…

A: DNA RNA hybrid is a formed when one strand is DNA and another strand is RNA. In DNA Thymine is…

Q: Give the sequence of the complementary DNA strand for the DNA chain with the following base sequence…

A: DNA means deoxyribonucleic acid. DNA acts as the genetic material in most of the organisms present…

Q: When proteins recognize and bind to a specific sequence in DNA, why do they usually just recognize…

A: DNA binding proteins are proteins that bind to single or double stranded DNA generally in the major…

Q: Within a protein, certain amino acids are positively charged (e.g.,lysine and arginine), some are…

A: DNA or the deoxyribonucleic is the defined genetic material and it is made up of a base, deoxyribose…

Q: a) One DNA strand of Chromosome #12 has the following nucleotide sequence: TAC/CGC/CCT. What…

A: DNA is a double stranded helical structure present inside the nucleus. It acts as a hereditary…

Q: The top side of this figure offers more opportunities (for each base pair) that can lead to highly…

A: A single stranded nucleic acid is formed by joining the nucleotide units together through…

Q: the human immunodeficiency virus HIV uses RNA rather than DNA to encode genetic information. During…

A: Answer: Introduction: The human immunodeficiency viruses (HIV) are the type of a subgroup of…

Q: The following sequence is a double stranded DNA.…

A: The promoter region is a crucial segment of DNA located upstream (in the 5' direction) of a gene…

Q: If an RNA strand generates its complementary strand, thus producing a double helix, will a molecule…

A: Nucleic acids are the main information carrying molecules of the cell and by directing the synthesis…

Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: In an RNA strand that is ready for translation, what is the base pair rule that would apply?

A: The translation is the process by which a protein is synthesized from the information contained in a…

Q: Given the sequences below select all that may have trouble becoming alpha helices. (Select all that…

A: It is the amino acid sequence of a peptide chain that determine which secondary structure the…

Q: Which conditions favour the A and Z conformations of DNA?

A: DNA is the chemical molecule that carries all living things with genetic instructions. Two strands…

Q: (a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue…

A: The given figure shows the mechanism of a DNA nuclease. Nucleases breaks the phosphodiester bonds of…

Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and…

A: DNA is a molecule that is in charge of bearing and transmitting inherited information or genetic…

Q: Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to…

A: Amino acids are the basic units (monomers) that makeup proteins. They consolidate to frame short…

Q: Explain why DNA replication proceeds only in the 5′ to 3′direction.

A: DNA replication is the process through which two identical DNA molecules are produced from a…

Q: The two outside rails of tge double helix are called

A: DNA (deoxyribonucleic acid) belongs to a class of molecules known as nucleic acids. DNA molecules…

Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…

A: Mutation can be divided into several categories. The types of mutation include missense mutation,…

Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…

A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be…

A: The central dogma of molecular biology is the synthesis of mRNA and polypeptide chain by…

Q: "One gene makes one RNA makes one protein". Is this true? Explain.

A: The "one gene makes one RNA makes one protein" dogma simplifies how genes are expressed. In general,…

Q: What is the protein product of the following DNA sequence? 5'-AACTCCGACTACGCTCCATTTCGAGCA-3'…

A: Proteins are complex biomolecules made up of chains of amino acids that fold into specific…

Q: Write the complementary strand to the following single-stranded DNA and label the 5' and 3' ends:…

A: DNA is the molecule found inside cells that carries the genetic data required for an organism's…

Q: The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: DNA is a double helical structure with two DNA strands. One strand serves as a template for the…

Q: In Figure 1-8b, can you tell if the number of hydrogenbonds between adenine and thymine is the same…

A: DNA (Deoxyribonucleic acid ) the building blocks of DNA are the Nucleotides Nucleotides are made up…

Q: Consider the following sequence of DNA: 3' - TACATGIIGTAG-5' a) Create a nonsense mutation with the…

A: DNA contains the genetic information for the physical characteristics of the human body. The DNA…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: All 20 of the amino acids coded for by DNA are L configuration. With one exception, theyalso all…

A: The question is asking us to identify the one amino acid that has an R absolute configuration, while…

Q: This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top…

A: Transcription is the process of the formation of RNA from DNA. DNA contains nucleotides with…

Q: (a) Write the complementary base sequence for the matching strand in the DNA section shown below:.…

A: Introduction According to Chargaff's rules, DNA from any cell of any organism should have a 1:1…

Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…

A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…

Q: To which end (5′ or 3′) of a newly synthesized strand of DNAdoes DNA polymerase add a nucleotide?

A: DNA (Deoxyribonucleic acid) replication is the coping of the double-stranded DNA to produce 2…

Q: Problem 1: a) Given the strand of the DNA sequence below, REPLICATE its complimentary DNA partner…

A: DNA replication is described as process in which the double stranded DNA molecule is copied into two…

Q: One of the original structures proposed for DNA had all the phosphate groups positioned at the…

A: A structure for nucleic acid has already been proposed by Pauling and Corey. Their model consists of…

Q: One stand of DNA reads: GACTTCAGATC Whay would the complementary strand be?

A: One stand of DNA reads: GACTTCAGATC What would the complementary strand be?

Question

If the nucleotide at position 23 in thw first strand of DNA ia changed to "A", what effect would this have on the protein produced?

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
List the four types of noncoding DNA (see Section 27.2). Give the function of each, if it is known.
Polyglycine, a simple polypeptide, can form a helix with φ = -80°, ψ = +150°. From the Ramachandran plot (as shown), describe this helix with respect to handedness.
How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside triphosphates (precursors of RNA strand) differ from each other?
If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = arginine
Explain why two metal ions play important role on the palm domain of DNA polymerase.
DNA is damaged when a base from the DNA chain is removed after an alkylation has occurred. In a depurination reaction, the purine nitrogenous base is displaced from its sugar as shown in this reaction. Draw the mechanism for this reaction and suggest a reason why it occurs so easily. HN' P H2N .N H,O HN° + Pi ОН N- H2N° ОН ОН ОН ОН
This is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?
If a fragment of one DNA strand has the nucleotide sequence TGGCTA, then the comple- mentary fragment in the DNA double helix will have which of the following sequences? A TAGCCA B n D ACCGAU TGGCTA ACCGAT
How would the uniform 2 nm diameter of DNA be affected iftwo purines or two pyrimidines could pair with each other?