Answered: If the nucleotide at position 23 in thw…

If the nucleotide at position 23 in thw first strand of DNA ia changed to "A", what effect would this have on the protein produced?

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Related questions

Q: Can a DNA strand bind to a complementary RNA strand? Explain.

A: DNA is the main constituent of the chromosome. It contains all information about protein that forms…

Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…

A: Central dogma is the process where in the information stored in nucleic acids is transferred to…

Q: If the sequence of a gene is: 3'TACATACCAACTGAGGATCGC5' 5'ATGTATGGTTGACTCCTAGCG3' And the RNA…

A: DNA is a double stranded helical structure found generally in Eukaryotes and prokaryotes while in…

Q: The coding strand has the following sequence. Please answer the questions below with regard to this…

A: The coding strands run in 3' to 5' direction and has codons it is transcribed as it is in the mRNA…

Q: Do any strands of nucleic acid exist in nature in which part of the strand is DNA and another part…

A: DNA RNA hybrid is a formed when one strand is DNA and another strand is RNA. In DNA Thymine is…

Q: If you had a protein that developed a mutation that changed its TEMPLATE strand from 5’GAT 3’ to…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which of the following sequences is most likely to form an a helix?

A: An alpha helix is a sort of secondary structure, which describes how a protein's main chain is…

Q: Which strand was used to form the following amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: The four bases of DNA—the A, C, G, and Ts—are strung together in such a way that the cellular…

Q: The base sequence of one DNA strand is given. Use base pairing rules to give the other DNA strand.…

A: The base pairing rules are: G is replaced by C C is replaced by G A is replaced by T and T is…

Q: Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and…

A: The synthesis of m RNA from DNA is called transcription.

Q: If an RNA strand generates its complementary strand, thus producing a double helix, will a molecule…

A: Nucleic acids are the main information carrying molecules of the cell and by directing the synthesis…

Q: Within the template strand of the DNA in a gene, the sequence TAT is changed by mutation to TAC.…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: In an RNA strand that is ready for translation, what is the base pair rule that would apply?

A: The translation is the process by which a protein is synthesized from the information contained in a…

Q: Given the sequences below select all that may have trouble becoming alpha helices. (Select all that…

A: It is the amino acid sequence of a peptide chain that determine which secondary structure the…

Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/or base) is/are found in the major and…

A: DNA is a molecule that is in charge of bearing and transmitting inherited information or genetic…

Q: A segment of one strand of a double-strandedDNA molecule has the sequence 5�-ACTTTCAGCGAT-3�. Whatis…

A: Transcription is the process of making an RNA copy of a gene sequence. As the nucleotide sequence of…

Q: Do any strands of nucleic acid exist in nature in which part of the strand is DNA and part is RNA?…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms (except few viruses) that…

Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…

A: As in the question, the sequence of DNA template is :3'- TAC TGG CCG TTA GTT GAT ATA ACT -5' Then,…

Q: The first 15 bases of the original coding informational strand of DNA (which continues after what is…

A: Mutation can be divided into several categories. The types of mutation include missense mutation,…

Q: Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA:…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: Which strand was used for the following old amino acid. strand 3 "ATGGAATGTTTACCCGTATTATACGGATAGACG…

A: By the process of transcription mRNA is produced from the DNA. the transcription process occurs…

Q: The following nucleotide sequence is found on the template strand of DNA. First, determine the amino…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: If the sequence in the coding strand of DNA for a particular amino acid is 5'AGT3', then the…

A: Introduction We all know that central dogma is a very important phenomenon in our cell. In this…

Q: Using this strand of DNA (TACAACTGA), show what a substitution would look like”

A: Substitution is a type of genetic mutation in which there are three possibilities after the…

Q: "One gene makes one RNA makes one protein". Is this true? Explain.

A: The "one gene makes one RNA makes one protein" dogma simplifies how genes are expressed. In general,…

Q: Which of the follwing enzymes adds incoming deoxyribonucleotid triphosphates to the 3' OH of the…

A: Deoxyribonucleotides or deoxyribonucleoside triphosphates (dNTPs) are the building blocks of DNA.…

Q: Describe the effect on the protein if the base pair #6 in the parent DNA chain is misted from G/C to…

A: Deoxyribonucleic acid (DNA) is the foremost key genetic constituent of all life forms. It is further…

Q: LEU VAL HIS VAL Write the nucleotide sequence of the template strand that corresponds to these…

A: Transcription Synthesis of mRNA from DNA Translation Converting genetic information into…

Q: From the following DNA strand: AAGCTAGGATTGCC How many codons would be present?

A: A codon is made up of three nucleotides. Such codons are abundant in messenger RNA and consist of a…

Q: What is the name of the enzyme that add nucleotides to a growing DNA strand? What kind of bonds…

A: DNA strands are essentially polymers that comprise of deoxynucleoside monophosphate that are linked…

Q: Cystic fibrosis (CF) is an inherited disorder caused by different types of mutations, many of which…

A: CF is caused by a mutation in a gene called the cystic fibrosis transmembrane conductance regulator…

Q: A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will…

A: During transcription process, the strand used as template is known as template strand which sets in…

Q: All 20 of the amino acids coded for by DNA are L configuration. With one exception, theyalso all…

A: The question is asking us to identify the one amino acid that has an R absolute configuration, while…

Q: What would the effect be if there was a substitution of one nucleotide for another?

A: Nucleotides:These are the building blocks or structural component of the deoxyribonucleic acid or…

Q: If one side of the helix is CACTGGACTGTG, the complementary side would be??

A: There are two types of nucleic acids present in our body, DNA and RNA. DNA is the genetic material…

Question

If the nucleotide at position 23 in thw first strand of DNA ia changed to "A", what effect would this have on the protein produced?

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Given the amino acid chain below, get the (a) translation strand, (b) transcription strand strand. , and (c) DNA MET-THR-THR-PRO-CYS-THR-TYR-THR-GLY-ASP-LEU-THR-GLY-MET-ILE-LEU-THR-ILE-ARG-PRO-ILE-LEU-ILE- STOP
Polyglycine, a simple polypeptide, can form a helix with φ = -80°, ψ = +150°. From the Ramachandran plot (as shown), describe this helix with respect to handedness.
What is the effect of the altered amino acid sequence in Hb S that causes the cells to form sickle shapes?
In eukaryotes, the Replication factor C (RFC) is a clamp loader. In the absence of RFC, what would be the consequences to the outcome of DNA replication? Explain.
How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside triphosphates (precursors of RNA strand) differ from each other?
If the following nucleotide sequence, CTC/TGT/AAG/ACC/TTT experienced a mutation resulting in the deletion of the second cytosine in the first DNA triplet so the sequence is now CT_/TGT/AAG/ACC/TTT, what would be the amino acid sequence created from this mutated DNA strand? Table of mRNA codons UUA, UUG = leucine AGG, AGA = arginine %3D CAU, CAC = histidine GUU, GÜC, GUA = valine GAA. GAG=glutamic acid GCU, GUA, GUG = alanine GAU, GAC = asparagine GGU, GGC, GGA = glycine UCA, UCU =serine CGU, CGC, CGA = arginine
Since the sugars and phosphates are the same on a DNA strand, we represent the strand with the nitrogen bases. If the first strand of DNA is AGCTGCAAT, what would be the nitrogen base sequence of the second strand?
Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro in
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?
Create the RNA strand to be synthesized from the DNA double strand below and explain this synthesis, including the functions of the molecules responsible for synthesis. 5’-ATCGCTTGTTCGGAA-3’ 3’-TAGCGAACAAGCCTT-5’