If the GAATTC palindrome is repeated four times on the same piece of linear DNA, and the restriction enzyme that recognizes that base sequence is present and digests the DNA, how many DNA fragments will be produced?

If the GAATTC palindrome is repeated four times on the same piece of linear DNA, and the restriction enzyme that recognizes that base sequence is present and digests the DNA, how many DNA fragments will be produced?

Name: If the GAATTC palindrome is repeated four times on the same piece of l
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: If the GAATTC palindrome is repeated four times on the same piece of linear DNA, and the restriction enzyme that recognizes that base sequence is present and digests the DNA, how many DNA fragments will be produced?

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter21: Dna, Genes, And Biotechnology

Section: Chapter Questions

Problem 8RQ

See similar textbooks

Similar questions

A restriction endonuclease breaks a bacterial plasmid into sticky ends to create recombinant DNA. The same restriction endonuclease is used to cleave the DNA segments that will be added to the plasmid. What are sticky ends, and why are complementary sticky ends on the target DNA and the plasmid it will be inserted into so important?
You have a recombinant plasmid containing a vector and a segment of foreign DNA, both equal sizes. Draw a picture of this recombinant plasmid labeling foreign and vector regions. Where the foreign DNA meets the vector, there is a cut site for restriction enzyme ABC1. When the recombinant plasmid is cut by ABC1, how many fragments do you expect to be produced? Identify these fragments.
A) For this DNA fragment (from 5' to 3') "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary strand B) What are the products when the DNA with the above sequence is incubated with the restriction enzyme EcoRI C) What are the products when the DNA with the above sequence is incubated with the restriction enzyme Mspl D) Draw the first two (2) base pairings of the DNA molecule from the 5' end and label all key elements of the molecule including the bonds involved
In the formation of recombinant DNA, a restriction endonuclease cuts a bacterial plasmid to give sticky ends. The DNA segments that are to be added to the plasmid are cleaved with the same restriction endonuclease. What aresticky ends and why is it important that the target DNA and the plasmid it will be incorporated into have complementary sticky ends?
Restriction sites are palindromic; that is, they read the same in the5' to 3' direction on each strand of DNA. What is the advantage ofhaving restriction sites organized this way?
A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?
If the GAATTC palindrome repeats are randomly found along the DNA strand, then what can you say about the sizes of the fragments that will be produced when the DNA is digested with a restriction enzyme that recognizes that sequence? How does the total length of the fragments relate to the size of the original DNA fragment?
In Cohen-Boyer’s recombinant DNA procedure, ___i___ must be used for both the bacterial DNA and the amphibian DNA ___ii___ a) the same restriction enzyme; so that the restriction sites are identical in the DNA of each species b) different restriction enzymes; So that the genes outside the restriction site are maintained c) different restriction enzymes; to ensure that the newly introduced genes are maintained in the bacterial DNA d) the same restriction enzyme; to ensure that the newly formed DNA can replicate
Referring to Figure 7-20, answer the following questions:a. What is the DNA polymerase I enzyme doing?b. What other proteins are required for the DNApolymerase III on the left to continue synthesizingDNA?c. What other proteins are required for the DNApolymerase III on the right to continue synthesizingDNA?
Name the enzymes that cut the DNA at specific sequences and create sticky ends.
A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HindIII (recognition sequence is AAGCTT)
A plasmid DNA and a linear DNA (both of the same size) have one site for a restriction endonuclease. When cut and separated on agarose gel electrophoresis, plasmid shows one DNA band while linear DNA shows two fragments. Explain.