If a DNA molecule with the following sequence of bases undergo replication, what would be the first 5 bases in the 3’end of its complementary strand
Q: A circular molecule of DNA contains 1 million base pairs. If the rate of DNA synthesis at a…
A: in prokaryotes, the genomic DNA is in a circular format and adopt the theta replication model,…
Q: Each single strand of DNA has a phosphate-sugar _________________ on the outside.
A: backbone
Q: Which of the following statements about DNA is true?
A: Answer is option a.)The two strands are held together by hydrogen bonds.
Q: Which dna strand will be synthesized continuously during dna replication? a.The strand that is…
A:
Q: A DNA strand has the following sequence: 5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′In which…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: One strand of a single DNA helix is labeled red while the other strand of the same DNA helix is…
A: Answer: DNA : Deoxyribonucleic Acid is the double stranded helix structure comprises genetic…
Q: Match the following descriptions with the enzymes involved in DNA replication. 1. Adds an RNA primer…
A: Replication is the synthesis of new DNA molecules from the parental DNA.
Q: How can replication proceed along the DNA if the two strands are going in opposite directions?
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: The following DNA sequence is at the start of a DNA strand: 3'—AATTCGAGATTCA—5'. Which of the primer…
A: The primer is the sequence of ribonucleotides which has free hydroxyl end for action of DNA…
Q: What is carbohydrate ring number and how does it help with understanding DNA replication
A: Carbohydrate ring number is the number that is assigned to the carbon ring for the presence of a…
Q: If a sequence of one strand of DNA is 5'-TGACTATC-3', what is the complementary strand?…
A: DNA is a macromolecule and is composed of two complementary strands. Bonds which is formed between…
Q: In the replication of a DNA molecule, two daughter molecules, Q and R, are formed. The following…
A: DNA replication is a biochemical process in which DNA molecules produce duplicate molecules of…
Q: Which of the following statements about DNA replication is FALSE? Select one: Unwinding of the…
A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…
Q: . Why is DNA synthesis continuous on one strand and discontinuous on the opposite strand?
A: DNA replication is the biological process by which DNA synthesis two identical replicas of itself…
Q: 10
A: DNA replication is a process by which new copy of DNA molecules are made by DNA polymerase.
Q: the diagram below, a dotted line represents newly-synthesized DNA. What process is being shown?…
A: DNA replication is a process which is involved in the production of the two identical copies of the…
Q: Shown below is a hypothetical replication bubble. In what direction does the new strand that uses…
A: In the given image, we are shown the process of DNA replication in which new strands are synthesized…
Q: In the diagram of replication shown here, fill in the blanks with the appropriate terms: (a) base…
A: Transmission of chromosomal DNA from generation to generation is crucial to cell propagation. This…
Q: If a cell were damaged, & DNA ligase could no longer be produced, how would replication be affected?
A: Each strand of DNA participates in DNA synthesis due to its double helix structure. DNA synthesis is…
Q: During DNA replication, the new strand that undergoes continuous replication is called the leading…
A: 1. statement is true. One strand is synthesized continuously in the direction of the replication…
Q: ure 1 above shows that remdesivir “mimics” an important component of RNA replication. Which…
A: A broad-spectrum antiviral drug that is injected intravenously is called Remdesivir. This medication…
Q: DNA replication described as “semiconservative
A: DNA Replication It is the process by which a double stranded DNA can form it's replica or copy.
Q: In the replication of a DNA molecule, two daughter molecules, Q and R, are formed. The following…
A: DNA replication is the process of producing a DNA strand from the exiting DNA strand by dividing the…
Q: During DNA replication, the template sequence 5' ATAGGCC 3' would produce which one of the following…
A: Replication is a biochemical process by which the DNA is synthesized on itself. It is mode by which…
Q: Which of the following is not depicted in the diagram attached? A. Okazaki fragment B. Replication…
A: Origin of replication is not depicted in the diagram. An origin of replication is a sequence of DNA…
Q: Referring to the figure, what bases will be added as DNA replication proceeds on the bottom strand?…
A: Answer: REPLICATION: It is the step in the central dogma in which synthesis of DNA occured to form…
Q: What is the function of DNA primase in DNA replication? O to insert new bases during elongation,…
A: DNA is a molecule made up of a chain of identical five-carbon sugars (polymers) that are linked…
Q: Which of the following is not depicted in the diagram?* O Okazaki fragment O Replication fork O…
A: The diagram is showing ongoing Replication. Replication is the process by which double stranded DNA…
Q: Which of the following steps in DNA replication would occur second? 1.DNA molecule separates into…
A: Replication occurs in three major steps: the opening of the double helix and separation of the DNA…
Q: Please help us explain our dna replication model Yellow is thymine, red is adenine, blue is…
A: Complementary base pairing:- The standard arrangement of bases in nucleotides in relation to their…
Q: In the process of DNA replication, there are four important enzymes. Construct a table, provide what…
A: DNA replication is semi conservative process involves process of producing two identical DNAs from…
Q: Each DNA double helix has a backbone that consists of alternating ___. covalent and ionic bonds…
A: DNA is the carrier of genetic information in most organisms. It is helical in structure with two…
Q: Which of the following statements are TRUE? I. DNA replication is a semiconservative process…
A: The true statement with explanation is discussed in step 2.
Q: DNA nucleotides are joined together by blank bonds between the sugar and phosphate groups to make a…
A: DNA is a polymer of nucleotides and is composed of two polynucleotide chains.
Q: If a DNA strand has the nucleotide sequence of CCGAGATTG, what is the nucleotide sequence of the…
A:
Q: Which of the following enzymes has a major role in joining of DNA fragments (Okasaki fragments)…
A: DNA gyrase - It is an bacterial bacterial enzyme that reduces the topological strain in ATP.…
Q: Why does DNA have a leading strand and a lagging strand during replication? Select the correct row…
A: Replication is the process of copying the DNA strands. It occurs through a series of events with…
Q: Which of the following statements are TRUE? I. DNA replication is a semiconservative process…
A: INTRODUCTION DNA Deoxyribonucleic Acid, is the genetic material shows a semiconservative mode of…
Q: Using the figure below, which end of the double helix,"A" or "B", would be considered the 5 prime…
A: Introduction DNA is an organic molecule that includes genetic information as well as instructions…
Q: Number the steps of DNA replication in the correct order (1, 2, 3) a) ______ Polymerase travels down…
A: Correct order is 1.)- b. 2.)-a. 3.)-c
Q: Describe three (3) effects on DNA replication if DNA polymerase could build DNA in both directions –…
A: DNA is a polymer of nucleotides and is synthesized by the process of replication.
Q: The sequence below is one strand from a double-stranded DNA molecule. How many hydrogen bonds hold…
A: In a double-helix, DNA is made up of two strands of nucleotide or nitrogenous bases which are…
Q: What would happen to the replication process if the growing DNA chain did not have a free 3' end?
A: DNA replication is the process by which a double stranded DNA molecule is copied to produce two…
Q: Which of the following statements best explains the mechanism for DNA replication? DNA replication…
A: Ans-DNA replication is semi-conservative, because each DNA strand serves as a template during…
Q: Using the correct base pairing rules for DNA replication, what would be the complementary strand for…
A: Rules of base pairing A with T: The purine adenine(A) always pairs with the pyrimidine Thymine…
Q: Identify two important enzymes involved in replication. Where does replication occur in the cell?…
A: As there are many questions given in one, the solution is provided only to the first three…
Q: The following diagram represents a DAN molecule that is undergoing replication. Draw in the strands…
A: The replication of DNA in eukaryotic cells is interrupted. DNA polymerase produces DNA in the 5' to…
If a DNA molecule with the following sequence of bases undergo replication, what would be the first 5 bases in the 3’end of its complementary strand?
Step by step
Solved in 2 steps
- Why is DNA replication called semiconservative?What is the importance of complementary base pairing to DNA replication?If the sequence of one single strand of DNA is C-A-A-G-T-A-G-G-C-T, what is the sequence of the complementary strand? Describe the origin of each strand of the new double helices created after DNA replication. Why is DNA replication important to the growth and development of a multicellular organism? Place the following terms in the correct order from smallest to largest: Nucleosome, supercoils, coils, chromosome, DNA double helix
- If one of the strands of DNA has the following sequence of bases running in the 5-S3' direction,5'-G-G-A-C-A-A-T-C-T-G-C-3' what base is closest to the 5'-end in the complementary strand?Why does DNA have a leading strand and a lagging strand during replication?Select the correct row below that fills in the following blanks to answer the question above.___1st___ has to attach the new free-floating nucleotides to the ___2nd___ of the newly formed strand. The two strands of a DNA molecule are antiparallel, so in order for the lagging strand to be formed in the same direction, it has to be done in Okazaki fragments going in a ___3rd___ direction. Select one: a. 1st 2nd 3rd DNA polymerase 3' end 5' to 3' b. 1st 2nd 3rd DNA polymerase 5' end 3' to 5' c. 1st 2nd 3rd DNA ligase 3' end 5' to 3' d. 1st 2nd 3rd DNA helicase 5' end 3' to 5'In NOT more than 200 words, explain how the double-helical structure of DNA suggests a mechanism for DNA replication?
- Draw the steps of DNA replication. Use the following nucleotide sequence as reference: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’What statement about DNA polarity is TRUE? One end of the chain has a 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has a free 5'-OH group or 5'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group. None is linked to another nucleotide. One end of the chain has a free 3'-OH group or 3'-OH group attached to a phosphoryl group. The other end of the chain has a free 3'-OH group, which is linked to another nucleotide. One end of the chain has only a free 5'-OH group. The other end of the chain has a free 3'-OH group. Neither is linked to another nucleotide. One end of the chain has a free 5'-OH group. The other end of the chain has a free 3'-OH group.DRAW A DNA STRAND WITH 10 ADENINE BASES FOLLOWED BY 10 CYTOSINE BASES. IF THAT SAME STRAND BONDED TO A STRAND OF 15 THYMINE BASE AND 5 GUANINE BASES, HOW WOULD THE DOUBLE HELIC SHAPE VARY FROM A TYPICAL DNA DOUBLE HELIX?
- Spontaneous deamination of cytosine bases in DNA takes place at low but measurable frequency. Cytosine is converted into uracil by loss of its amino group. After this conversion, which base pair occupies this position in each of the daughter strands resulting from one round of replication? Two rounds of replication? (a) How many different 8-mer sequences of DNA are there? (Hint: There are 16 possible dinucleotides and 64 possible trinucleotides.) We can quantify the information- carrying capacity of nucleic acids in the following way. Each position can be one of four bases, corresponding to two bits of information (2² = 4). Thus, a chain of 5100 nucleotides corresponds to 2 × 5100 = 10,200 bits, or 1275 bytes (1 byte =8 bits). (b) How many bits of information are stored in an 8-mer DNA sequence? In the E. coli genome? In the human genome? (c) Compare each of these values with the amount of information that can be stored on a computer compact disc, or CD (about 700 megabytes).A B-DNA molecule has 1 million nucleotide pairs. How many complete turns of the helix are there in this molecule?For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand