Identify the eukaryotic level of gene regulation. Choose the correct answer below. a. Pre- transcriptional control b. transcriptional control c. translational control d. post-translational control 9. Levels of gene regulation

Q: 10. a. Describe an operon? b. How lac operons controls gene expression in bacteria

A: (a) An operon is a functional unit of DNA containing a set of genes including structural gene, a…

Q: You are curious to identify the region of the gene X sequence that serves as an enhancer for gene…

A: Nascent RNA (ribonucleic acid) sequencing analysis is a tool for enhancer identification. Some…

Q: association of 2alpha and 2 beta chains to form adult hemoglobin     identify which describes the…

A: Translation is process of conversion of RNA to protein.

Q: compare and contrast the negative and positive regulation of prokaryotic gene expression

A: The operon is a set of genes transcribed under the control of the operator gene. More particularly,…

Q: Translational control of gene expression occurs within thea. nucleus.b. cytoplasm.c. nucleolus.d.…

A: A gene is the fundamental biology unit just like the atom. Gene expression is the process by which…

Q: Define the following terms:a. mRNA scanningb. transcript localizationc. glycosylationd. targetinge.…

A: The proteins are synthesized from the mRNA, which is modified post-translationally in ER. After…

Q: A geneticist induces a mutation in eukaryote cells. The mutation results in an inability to form the…

A: Mutation results in alteration of a nucleotide sequence of DNA which caused due to the mistake in…

Q: What is the mechanism by which an RNA transcript can be used to silence expression of the same gene?…

A: Recombinant DNA technology (rDNA technology) is very helpful for analyzing the entire genome of a…

Q: Imagine you are a cell and you need to activate ("turn on") a gene as quickly as possible.  What…

A: Gene expression is a tightly regulated process that allows a cell to respond to its changing…

Q: Which of the following statements about gene regulation is false?   a. An operon contains DNA…

A: Introduction Gene expression is the process in which the genetic information present in the DNA…

Q: Mature human insulin is synthesized from a single Gene but contains two polypeptide chains (A and B)…

A: Introduction Pancreas is a holocrine gland present in our body. It has both endocrine and exocrine…

Q: Which of the following is the best description of a transcription factor? A. A protein that brings…

A: Transcription is the process which leads to conversion of DNA to RNA. One distinguishing aspect of…

Q: Harry Potter speaks parseltongue(he can talk to snakes). Dumbledore explains that this is because…

A: Language is an example of a trait that is learned and developed throughout a lifetime. Language is a…

Q: Post-translational modifications of proteins can affect which of the following? a. protein function…

A: When RNA has been transported to the cytoplasm, it is being translated into protein whose control is…

Q: functional insulin required the association of two polypeptides known as the A and B chains…

A: Pre transcription control involves in DNA methylation.  Transcriptional control involves in…

Q: Exposing Escherichia coli (e.coli) to ionizing radiation results in DNA damage. Say you perform an…

A: Gene expression is the process by which information from a gene is used in the synthesis of a…

Q: Select the answer that correctly expresses a valid comparison between transcriptional regulation in…

A: Transcriptional regulation is far more complex in eukaryotes than in prokaryotes. Prokaryotic…

Q: Transcriptional regulation often involves a regulatory protein that binds to a segment of DNA and a…

A: The process involved in regulating copying of instruction from the DNA into RNA is called…

Q: Genes of related function frequently cluster into: please explain the answer  a.transcripts…

A: Gene is the functional part of the DNA that undergoes transcription and produce RNA. They have a…

Q: Which of the following is true of CpG islands? a. They are methylated near promoters of actively…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains. It coils around each…

Q: Which of the following are steps of transcription? Select all that apply. a.RNA polymerase…

A: The function of a gene can be studied through expression in a particular cell and its interactions…

Q: Gene expression regulation by methylation of the cytosines in a promoter would be considered

A: Answer - Option B - Transcriptional regulation

Q: Which of these BEST DESCRIBE tryptophan in the Trp Operon? A. Acts as a corepressor B. Acts as a…

A: An operon is a unit of genetic material that functions in a coordinated manner through the use of an…

Q: . rat liver mannan-binding protein gene yields two different mRNA sizes 1.4 and 3.5 kb identify…

A: Pre transcriotion contol involved in DNA methylation and chromatin packing . Transcription control…

Q: 35. rat liver manan-binding protein gene yields two different mRNA sizes - 1.4 and 3.5kb identify…

A: Mannan-binding protein (MBP), a mannose-binding lectin (MBL) protein, is a protein involved in the…

Q: Define the following terms: a. epigenetics b. CpG island c. epimutation d. DNA methylation e.…

A: Definitions are explained.

Q: Define the following terms:a. cohesinb. transcription factoryc. P bodiesd. CTCFe. ENCODE

A: There are cellular pathways that help to transfer genetic information and encode it to the protein.…

Q: Proteins that regulate gene expression by directly binding to the DNA are known as _____.​

A: Answer:  GENE EXPRESSION = This is the process of conversion of all stored information in DNA in to…

Q: Is each of the following statements true or false? A. An enhancer is a type of regulatory element.…

A: Gene is a section of DNA with information to construct a protein. Gene is actually made from a…

Q: 5) The bacterial Lac operon is an example of transcriptional regulation. What are the major…

A: Using an example of Escherichia coli for the bacterial lac operon. Escherichia coli is a…

Q: The transcription initiation factor “recruited” together with RNA-Pol II in the formation of…

A: Transcription is a process of making an RNA copy from a gene’s DNA sequence. This is known as…

Q: For each of the following, match with the stage of gene expression being regulated.…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Which of the following does not accurately describe eukaryotic transcriptional factors? a. Changes…

A: Introduction Transcription factors are the proteins that specifically are involved in the…

Q: . heterochromatic regions decondense for gene expression a. pre-transcriptional control b.…

A: Heterochromatin regions are condensed regions of the chromatin that are transcriptionally switched…

Q: Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA?…

A: The given sequence belongs to the XPA gene of humans. This responsible for nucleotide excision…

Q: In the trp operon, tryptophan is best characterized as being a: A. repressor B. inducer C.…

A: Operon is clustered of Genes where a single mRNA consists of more than one functional gene.It is…

Q: Elaborate briefly on two distinct mechanisms of eukaryotic post-transcriptional gene regulation.…

A: Introduction :The regulation of gene expression at the RNA level is known as post transcriptional…

Q: Eukaryotic cells have multiple complex mechanisms for the regulation of gene expression, but a…

A: Answer :- a) Operons Explanation - Eukaryotic genes aren't organized into operons, therefore every…

Q: tight packing of previously less condensed chromatin   identify which describes the statement…

A: Post translational modifications in histone proteins can change the shape of chromatin, which can…

Q: Which of the following gene regulation mechanisms are found ONLY in prokaryotes?   a. coordinate…

A: DNA modifications can happen in both prokaryotes and eukaryotes, Transcriptional and Translational…

Q: Please choose the correct answer. The prokaryotic operator gene is turned on if a. a repressor…

A: An operon is a functional unit of genomic DNA that comprises a collection of genes that are all…

Q: What is one function of TFIIH during transcription?    a. Recruiting the TATA-box binding protein…

A: Transcription factor II Human is a crucial protein complex which have important role in…

Q: Explain the different events under post transcriptional modification. A. 5'capping B.…

A: Post-transcriptional modification, also known as co-transcriptional modification, is a series of…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.