How does the life cycle of a typical Red alga (Phylum Rhodophyta) differ from any other life histories covered in the course thus far? Don't forget to highlight these differences by comparing them to the basic types (i.e sporic, gametic, or zygotic meiosis)!
Q: Define about lactose (lac) operon ?
A: The lactose operon also known as the lac operon is a set of genes that are specific for uptake and m...
Q: When is melatonin usually produced in higher levels? O Melatonin levels remain constant throughout t...
A: Melatonin is a hormone produced largely by the pineal gland at night and has long been related with ...
Q: Directions: Solve these genetic problems. Be sure to complete the Punnett square to show how you der...
A: The alleles are the alternative forms of a gene that are located on the same locus of a homologous c...
Q: State the part of eye that constricts or dilates based on the amount of light in the environment. A....
A: 1. Pupil helps in constriction and expansion based upon the amount of light present in our environme...
Q: Draw the arms-legs-waist structure of FAS, and label where the different active sites are located.
A: Active Sites -- A substance which speeds up a chemical reaction - without being a reactant - is ca...
Q: 6. Enumerate the possible combination of alleles formed in each gamete after meiosis if the diploid ...
A: Number of possible combination of gametes is dependent on the number of heterozygous alleles. Hetero...
Q: 4. In pea plants, the round shape (R) is dominant over wrinkled shape (r) for seed shape and tall (T...
A: Mendel who proposed principles of mendelian inheritance
Q: Could a cell function if it were not enclosed by a selective barrier (i.e., a plasma membrane)?
A: Introduction: Cells are the building blocks of all living beings. Prokaryotes and eukaryotes are two...
Q: of the following is n atonin ephrine Foxine e of these is correct ngen an
A: Hormones are chemical messengers that carry messages from the gland they are secreted to the respect...
Q: According to modern sociobiological theories of about warfare which one of the following is not one ...
A: All the statements given are true except the third statement regarding the stages in the evolution o...
Q: QUESTION 4 Which of the following is an appropriate technique for gathering qualitative data? OA Foc...
A: Qualitative data:Qualitative data describes qualities or characteristics.
Q: Which step in the lytic cycle follows attachment of the virus and and release of DNA in to the host ...
A: 12) The answer of this question will be option (d). A lytic cycle is the cyclic process in which a v...
Q: https://coloradosun.com/2022/02/06/colorado-soil-dry-climate-change/ Did the author support his/her...
A: Environmental sociology is a branch of sociology that deals with the study of interactions between s...
Q: the vapor phase concentration in ppm(v)?
A: Vapour phase concentration is the amount of water vapor present in a unit volume of air, usually exp...
Q: oogenesis.
A: oogenesis -In the human female reproductive system, growth process in which the primary ...
Q: How can you tell whether or not there are blue kernels? The Y was dominant. Set up and complete a P...
A: Answer image 1
Q: 1. describe key aspects of the atmosphere related to human well-being, such as oxygen's role as a li...
A: Note :- Since you have asked multiple questions and as per bartleby guidelines im supposed to answer...
Q: The following figure is showing; Node Node Myelin sheath Node of Ranvier (a) Na+ ONa* Depolarization...
A: Axons are slender fibres that stretch from a neuron, or nerve cell, and are accountable for implemen...
Q: Why is the orientation of the bases on the inside of the DNA molecule important to the structure and...
A: DNA is an organic molecule that includes genetic information as well as instructions for protein cre...
Q: A medium containing an abundance of substrate was seeded with 20 mg/L VSS of an active mixed culture...
A: Detecting specific genes can be used to screen a collection of isolates and obtain the distribution ...
Q: Which of the following neurotransmitters does NOT have one NH2 unit in its structure? O serotonin O ...
A: Neurotransmitters are specific molecules that are released from the presynaptic neuron and responsib...
Q: (Plant Pathology) What is the importance of culture media in the diagnosis of plant disease?
A: It is critical that we understand microbes and their applications since they may be both useful and ...
Q: Describe the methods that are used to transfer ions across the cell membrane
A: The cell membrane are semi permeable and selective permeable. Ions and other molecules which are tra...
Q: a medical study, patients are classified in 8 ways according to whether they have blood type AB+, AB...
A:
Q: How do we isolate culture media (step by step process) and what is the purpose of bacterial culture ...
A: Introduction :- Microorganisms can be found in the natural environment, such as soil. They coexist w...
Q: TGGCGGCATTTTAACTTTCTTTAATGAATGCGGGCATATTTAATACGCGCTATGCGCATCGTATGCGAT-3' 1) What are the first five ...
A: Exons forms the final RNA transcripits and the introns are removed by RNA splicing. 1)first 5 deoxyr...
Q: Draw a diagram of a nucleotide with a ribosoe sugar. Number the carbons on the sugar.
A: Nucleic acids are made up of nucleotides, which are the basic building blocks. Long chains of nucleo...
Q: What eye phenotype is expected in a fruit fly with this genotype: w-,ey>Flp/ Y; FRT42D/ FRT42D, Ark8...
A: Question 7: The correct answer to this question is: 1. Curly Wings 2. No, mitotic recombiniation did...
Q: Which organ of man is homologous to the wings of birds? Justify your answer.
A: Organs apparently similar or dissimilar in structure and function but of similar embryonic origin an...
Q: Compare and contrast the receptors used by the innate vs. adaptive immune systems to recognize "non-...
A: Solution : Innate, or nonspecific, immunity is the defense system with which you were born. The adap...
Q: pathogen
A: Pathogen is a bacterium, virus, or other microorganism that can cause disease.
Q: as blue eyes while the man is brown-eyed who has a blue-eyed mother. (a) phenotypes rogeny. (b) phen...
A: Most of the genes associated with eye color are involved in the production, transport, or storage of...
Q: Describe the roles played by carbohydrates in cells: A.) Raw material B.) Structural support C.) Cel...
A: Carbohydrates are a class of biological macro-molecules that are important for day-to-day functions ...
Q: Which of the following is not true of all hormones; May bind with distant target tissue receptors O ...
A: Hormones are chemical messengers that are released from the endocrine glands. They can be proteinace...
Q: e-effect curve that is marked by the X is known as:
A: Dose effect curve is defined as the relationship between a given drug dose and its response. In this...
Q: [SELECT ALL THAT APPLIES] A prokaryotic ribosome is made up of the containing two subunits viz. the ...
A: Biofilms are multicellular communities made up of bacteria wrapped in a non-crystalline extracellula...
Q: What effect does melatonin have on the body? O. Increased levels cause alertness Two of these answer...
A:
Q: Which of the following best describe(s) the process of X-inactivation? Group of answer choices It o...
A: Human contains 23 pairs of chromosomes out of which 22 pairs are autosomes and one pair of sex chrom...
Q: The predicted outcome of the F1 cross is diagrammed in the Punnett square shown in the figure, where...
A: option (b) 1,2,3 have dark leaves.
Q: SPLIT DNA mRNA TRNA Codon Anticodon Amino Acid A T C G G C A T A G T A A
A: The DNA is the genetic material that is responsible for the production of RNA transcription process....
Q: Why must viruses be metastable?
A: Introduction A virus is a little piece of genetic information (DNA or RNA) encased in a protein coat...
Q: Write the advantages and disadvantages of applying such application in the DNA of an organism. 3. P...
A: GMOs Genetically modified organisms are those organisms whose DNA has been altered in order to enha...
Q: se you are given a plant belonging to the Division Gnetophyta, how would you tell the genus to which...
A: All the living organism are classifies into the five kingdoms. These five kingdoms includes Plantae,...
Q: Which of these is NOT a generally correct statement about bacterial transposons? Transposons...
A: Bacteria are microscopic organisms which is not visible with naked eyes. In our daily bacteria is ca...
Q: marijuana O alcohol O hallucinogens All of these are strongly impacted by the social setting.
A: All these are psychoactive drugs that stimulate some parts of the brain. These drugs make people fo...
Q: Members of Phylum are some of the largest protists on Earth. O Oomycota O Bacillariophyta O Phaeophy...
A: Protist is any eukaryotic organism which are unicellular and microscopic. These are nucleus and memb...
Q: ing to the video "Ben Goldacre: Battling Bad Science" from Assignment 5.2, which e statements is tru...
A: Placebo is a kind of substance which produces no medical effect. Placebo is given to create a false...
Q: The largest mass extinction on record is the mass extinction event. O Late Permian O Late Proterozoi...
A: According to law of superposition within a sequence of layer of sedimentary rock the oldest layer is...
Q: Explain three functionally distinct compartments in drug absorption 1.intracellular compartment 2.pl...
A: Fir drug absorption passive diffusion is the mechanism. For drug absorption in humans and related o...
Q: Describe how electrical stimulation is used in a cochlear implant, in motor prostheses, and in reduc...
A: The cochlear implant, which uses electric currents to directly stimulate the auditory nerve in a com...
Trending now
This is a popular solution!
Step by step
Solved in 4 steps with 1 images
- Zygomycete bread molds such as Rhizopus stolonifer (black bread mold) produce sporangia in both sexual and asexual reproductive cycles. Which of the following do the sexual sporangia of Rhizopus stolonifer originate from (i.e. what does the sporangia grow out of)? Select one: O a. from the aseptate hyphae O b. from the zygosporangium O c. from the substrate O d. from the gametangiaIdentify: 1. A part of the chloroplast in the green algae important in carbon dioxide fixation and for production and concentration of starch. 2. Subgroup of Kingdom Viridiplantae with cytokinesis marked by phragmoplast formation. 3. Subgroup of Kingdom Viridiplantae with centrioles and closed mitosis. 4. Chloroplast morphology of the Chlamydomonas. 5. The characteristic life cycle of Chlamydomonas. 6. Sexual reproduction in Chlamydomonas characterized by the fusion of morphologically similar gametes. 7. Sexual reproduction in Volvox characterized by the fusion of a large, immotile female gametes with small, motile male gametes. 8. The common name of the genus Chara. 9. The specific structure that produce the male gametes in Chara. 10. The specific structure that produce the female gametes in Chara.The Zygomycetes (bread molds) are a coenocytic fungus. This means that; Their hyphae lack crosswalls They only reproduce sexually They reproduce using conidia They have heterokaryotic hyphae
- Relate plasmogamy and karyogamy to the process of fertilization and describe whey we need to separate these two things in the life cycle of the fungi. Differentiate between the monokaryotic and dikaryotic conditions. Compare and contrast an animal life cycle with that of a typical mushroom including the haplophase, dikaryophase, and diplophase, products of meiosis, plasmogamy, and karyogamy.After plasmogamy has occurred, many molds (Mucoromycetes) exist in a heterokaryotic stage for up to centuries at a time. What occurs at the immediate end of this stage? The nuclei fuse in a process called karyogamy. The hyphae fuse in a process called karyogamy. Diploid spores are produced in various spore-producing structures. A haploid zygote is formed that becomes multicellular through repeated rounds of mitosis.Some fungi exhibit dimorphism, i.e. they can exist in both yeast and mold form. Why is this so? What advantage does this provide for these organisms?
- What is the ploidy level of the gametophyte generation in the Cycadophyta? O haploid (1n) diploid (1n) triploid (3n) O diploid (2n)In the pictures below, identify the arrowed reproductive structures of microscopic cyanobacteria based on the following descriptions: Akinetes are dormant structures larger than the vegetative cells, are rich in food reserves, and have thick walls. Most filamentous cyanobacteria develop akinetes in adverse conditions (e.g., winter, dry periods). When favorable conditions return, they germinate and produce new filaments. Hormogonia are short pieces of filaments consisting of 5–15 trichomes that fragment and develop into new filaments. Heterocytes (or heterocysts) are multicellular structures that have a thick and massive sheath, formed by members of the Nostocales. It is the location of the enzyme nitrogenase for nitrogen fixation, the conversion of nitrogen gas into ammonium and then amino acids. They may be intercalary or terminal in position and may germinate from either end or both the ends to give rise to new filaments. Non-filamentous cyanobacteria generally produce spores…Algae are autotrophs and can have photosynthesis, however, evolutionary evidence suggests that plants shared a common ancestor with only green algae and are closest relatives of Charophytes. What evidences support this statement? How an algal cell is different from fungal cells, even if both are eukaryotes? Why slime mold is a protist not a fungus even if it does not have chloroplast?
- Distinguish among fungi that are haploid, dikaryotic, or diploid by completing the following statements, referring to the figure as necessary. n+n sexual n diploid contains paired haploid nuclei dikaryotic 2n A haploid asexual Saved B Fungi reproduce both sexually and asexually. In terrestrial fungi, reproduction occurs in three stages. One stage, depicted in part A of the figure above, is termed point each cell is First, days, months, or years, the Another stage, depicted in part B of the figure above, is termed stage takes its name from the term for a hypha that each cell is C at which 20 hyphae pair up. Sometimes immediately, other times after hyphae make contact and fuse... This at which point Upon fusion, the hyphae are at the stage represented by part C of the figure above, stage, at which point each cell is termed the Reset *Label A-H from image as the following: I: Dikaryotic II: Basidiospores III: Plasmogamy IV: Meiosis V: Diploid VI: Haploid VII: Karyogamy VIII: ZygoteLabel the parts (number 1-4) of the diagram showing the life cycle of a Lycopodium sp. Indicate whether each of the labeled part is haploid (n) or diploid (2n).
