What is the specific base sequence found in human telomeres, and how does the base sequence contained in the telomeric regions of chromosomes differ from that found elsewhere in the chromosome?  (Please indicate both the base sequence and the 5’/3’ polarity.)

Q: A chromosome from a multicellular slime mold called purple oblex (Plasmodiophora oblexii) is 13%…

A: Chargaff’s rule is used in such calculation for determining the percentage of the DNA bases that…

Q: What direction does DNA polymearse only travel in?

A: The question is asking about the directionality of the enzyme DNA polymerase during the process of…

Q: Explain the role of boundary elements in the DNA. If you were to use gene editing technology to…

A: Detailed explanation: Let's break down the role of boundary elements in DNA and explore the…

Q: The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T,…

A: Most organisms contain DNA or deoxyribonucleic acid as their genetic material. It is a type of…

Q: What is the repetitive DNA sequence of telomeres in humans?

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more…

A: DNA is supercoiled structure which is present inside the nucleus The coiling of Dna is done by the…

Q: We seem to know more about the structure of eukaryotic chromosomal DNA than bacterial DNA. Discuss…

A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…

Q: I T?L|| ?L||?T |||| || |A| ||T|||c| |||| 6 4 5 “A. Denote the 5' and 3' ends of all of the DNA…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: You are working in a biotechnology lab and are analyzing DNA. You obtain a sample of a short…

A: DNA is present inside the nucleus and consists of instructions for the synthesis of protein. The…

Q: Describe the function and molecular structure of a telomere.

A: All cellular systems are controlled by proteins. Proteins are synthesized by the cell by a process…

Q: Which type/s of histones is/are not part of the histone octamer wrapped by DNA strands but is found…

A: Histones proteins are present as octamer (eight) complex at the center of nucleosome. It consist of…

Q: At the end of the short arm of human chromosome 16 (16p), several genes associated with disease are…

A: Telomeric DNA are conserved regions at the ends of chromosomes, (TTAGGG)n, approximately 20kb in…

Q: You have discovered a new species of plant. You isolate chromatin from the plant and examines it…

A: Histones are basic proteins that are rich in basic amino acids like arginine and lysine. These basic…

Q: In a numeric pyramid,is it possible the base to be smaller than the other levels?

A: A pyramid of numbers or numeric pyramid shows the total number of individual organisms at each level…

Q: Kree DNA has histone like proteins that wrap up in nucleosomes. The Kree have a core DNA length of…

A: Nucleosomes are the basic repeating unit of 'beads on a string' structure of eukaryotic chromosome.…

Q: The human genome contains 3 billion nucleotides arranged in a vast array of sequences. What is the…

A: Genes are the hereditary unit of an organism. The DNA (deoxyribonucleic acid) forms the genes. DNA…

Q: What are telomeres made of and Why do we need telomeres?

A: It refers to the segment of DNA occurring at the ends of chromosomes in eukaryotic cells to prevent…

Q: Which of the following is NOT an effect of histone acetylation on chromatin structure? Selected…

A: Histone acetylation is a post-translational modification that adds acetyl groups to lysine residues…

Q: How many nucleosomes form the “width” of the 300 Angstrom fiber, in chromatin packaging?

A: Each chromosome consists of a single, enormously long linear DNA molecule associated with…

Q: In chromosomes, doubly-stranded DNA wraps tightly around histone proteins. Think about the structure…

A: DNA It is a biomolecule that carries genetic information and information for the process of protein…

Q: You have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG…

A: DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: One of the following is a characteristic of eukaryotic genetic material? 1. Eukaryotic genetic…

A: DNA is the hereditary genetic material found in cells of living organisms. In eukaryotic cells, DNA…

Q: Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must…

A: Insulin is synthesized from preproinsulin. The preprotein is then cleaved by a proteolytic enzyme to…

Q: The A and G compositions (mole percent) of one of the strands of a duplex DNA is A = 27 and G = 30.…

A: DNA is the molecule that carries the genetic information for an organism. It is basically made up…

Q: How many different 8-mer sequences of DNA are there?

A: Oligonucleotides are short DNA or RNA molecules. They are characterized by the sequence of…

Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/orbase) is(are) found in the major and…

A: Nucleotides are composed of a phosphate group, a pentose sugar, and a nitrogenous base. The pentose…

Q: assuming a spacing of approxiametly 200 base pairs per nucleosome, how many molecules of histone H4…

A: A nucleosome is a unit of chromosome in Eukaryotic cells that is found inside the nucleus. It looks…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.