Q: Define the following: 1. Morphology - 2. Colony -
A: Colony morphology refers to the visible cultural features of a bacterial colony on an agar plate. In...
Q: 1. Which is the abiotic factor? A. Bacteria B. Dog 2. Which of the following is a characteristic of ...
A: A dynamic community that contains a set of physical, chemical, and biological variables in a specifi...
Q: 1. Explain how these body system help in maintaining homeostasis. a.Digestive System- b.Skeletal ...
A: Homeostasis:- Homeostasis refers to the tendency to maintain internal body temperature or is a self-...
Q: Why are fruit flies considered a model genetic organism? Would humans fit this description?
A: Introduction:- The study of how genes and traits are passed down from one generation to the next is ...
Q: Unlike most examples of this trait, the height characteristic that Mendel studied in pea plants exhi...
A: Mendel's experiment Mendel studied the seven contrasting characteristics of pea plants. These traits...
Q: What advantage does compartmentalization provide to a large and complex cell
A:
Q: MicroRNAS attach to MRNA. In doing this, they... O Lead to the production of more protein O Lead to ...
A: The control of gene expression through micro RNA is dones mainly by binding with the messenger RNA (...
Q: Can you help me identify the specific structure pointed
A: This is transverse section of kidney. The labelled pointed section attached below.
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: What are three actions you would take to reduce theglobal threats to human health and life from each...
A: Pathogenicity represents a specialization in a certain microorganism to replicate and damage host ce...
Q: What provides the negative charge associated with DNA? The phosphate groups The nitrogenous bases Th...
A: DNA (Deoxyribonucleic acid) is a molecule that is made up of two polynucleotide chains that coil aro...
Q: ANSWER THE FOLLOWING QUESTIONS: 1. What do you think is the strongest evidence that there is an evo...
A: One of the strongest pieces of evidence of the evolution of biodiversity is fossils. They occur in s...
Q: Make an introduction about communicable diseases involving the skin and eye.
A: Q. Make an introduction about communicable diseases involving the skin and eye. Answer - Communica...
Q: What are the advantages of metabolic channeling? Describe two mechanisms of metabolic channelirg
A: Since you have asked multiple question, we will solve the first question for you. If you want any sp...
Q: Adrenergic receptor agonist/s: Monoamine oxidase inhibitors Ephedrine Tamsulosin Neurotransmitter/s ...
A: Adrenergic receptor are cell surface glycoproteins that recognise and selectively bind the catecolam...
Q: 5. Molecule #5 a)What Group? (Carb, Lipid, Protein, or Nucleic Acid). b)Within the group, how would ...
A: Macromolecules are a large molecule that includes biomolecules such as protein, lipid, nucleic acids...
Q: What are some of the important trematode parasites of humans? How can they infect us? Enumerate thre...
A: A parasite is an organism that needs host organism to survive. Tapeworms are flat, parasitic worms.
Q: Auxin causes the bending of shoot toward light by?
A: Auxin class of plant hormones plant-growth regulators) with some morphogen-like characteristics. Au...
Q: One genotype in a very large and genetically variable population is favored in warmer than average y...
A: The correct answer is option (B) genetic variation will decrease as the genotype with the highest a...
Q: PLEASE ANSWER
A: Introduction:- mussels reproduce in an unusual and complex way, which includes a brief, mandatory pe...
Q: а ТЕМ.
A: cell biologist or researchers are examine cells and magnify organelles and track cells as they divid...
Q: Please answer to best of ability asap
A: Introduction Mutation is described as a change in nucleotide sequence or chromosomal structure that ...
Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...
A: The brown fur (BB) color is dominant to black fur (bb) color while pigment production (BB, Bb) is do...
Q: What is the name of the LT receptor which recognize the hla molecules of the graft
A: Introduction:- The human leukocyte antigen (HLA) system (also known as the major histocompatibility ...
Q: What is the number and types of lamprey species that are present in the Great lakes?
A: ANSWER;- 1. 5 number present in the Great lakes. Many people believe the obtrusive ocean lamprey is ...
Q: Dystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the consequ...
A: Dystrophin is a protein that helps keep muscle cells intact.
Q: A series of experiments shows that oil content in a diploid grain is influenced by four genes (a thr...
A: Introduction :- The phenotype of an organism is the sum of its observable traits. A significant dist...
Q: Some analysts argue that in order to continue usingoil at the current rate, we must discover and add...
A: Introduction: Exploration for oil and the manufacturing of its byproducts will be in decline or will...
Q: Which of the groups below is capable of only hydrophobic interactions?
A: In general, a molecule with more polar parts less non polar (hydrocarbon) part shows hydrophilic int...
Q: Explain why we say that photosynthesis feeds most life on Earth.
A: Plants absorb CO2 and water (H2O) from the air and soil during photosynthesis. Water is oxidized (lo...
Q: In the SIR model, individuals can enter but not leave the infected class. O individuals can leave bu...
A: * SIR ( susceptible, infectious, recovery/removed) model is classical model of disease transmission ...
Q: Explain why living things need to reproduce and discuss the types of reproduction
A: Reproduction is the process by which an independent individual is brought into existence by a preexi...
Q: Consider that leaves are added to a soil. The compound in the leaves that is most resistant to bacte...
A: Decomposition is process of decaying of materials.
Q: what does rennin do in the context of food?
A: Rennin also called as the chymosin is the protein digesting enzyme that curdles the milk by transfor...
Q: Explain Geological history of gymnosperms
A: Introduction :- Conifers, cycads, Ginkgo, and gnetophytes are among the gymnosperms, a clade of seed...
Q: In mice, brown fur color is dominant to black fur color. Another gene affects the production of pigm...
A: Given information Brown fur color is dominant (B). Black fur color is recessive (b). Pigment produc...
Q: Complete the colony morphology for the colonies pictured above: 1. Form - 2. Elevation - 3. Ma...
A: There are some important points: As it looks like blood agar which is enriched medium which mostly ...
Q: Create a semantic web of the concept of Evolution by Charles Darwin and Alfred Wallace. EVOLUTION
A:
Q: Identify a non-competitive inhibitor and the enzyme that it impacts. Describe how the competitive in...
A: Enzymatic activity turned up or down by activator and inhibitor molecules tat bind specifically to t...
Q: Table 14. Crossing Fl individual with another Fl individual Individual # 213 252 Gender Male Female ...
A: The answer is NO.
Q: Summarize Theodor Engelmann’s photosynthesis experiment
A: Photosynthesis is the conversion of light energy into chemical energy by phototrophs, which is then ...
Q: Which one of the following would upregulate a gene? Activator transcription factors O DNA Polymerase...
A: Gene regulation is crucial for viruses, prokaryotes, and eukaryotes because it enhances an organism'...
Q: Explain how streams can cleanse themselves andhow these cleansing processes can be overwhelmed.What ...
A: "Since you have asked multiple question, we will solve the first question for you. If you want any s...
Q: Sunhil suffers from a stroke and loses the ability to move his right arm and hand. However, after ph...
A: * stroke mainly affects the shoulder,elbow and upper limb and hand. *Stroke will usually affect the ...
Q: Discuss the changes and what is happening in the adolescent brain- explain thoroughly (Write in par...
A: As a result, the vast majority of adolescents are included in the Convention on the Rights of the C...
Q: What behavioral verbs do fish and humans have in common? How is swimming different in fish and human...
A: Behavioral verbs fish and human have Our voice Fish can't communicate, but they do have gills, whic...
Q: Compare the somatic and autonomic nervous systems
A: somatic nervous system is brain and spinal cord both are responsible for processing or integratin...
Q: Briefly outline the pathway by which the immune system becomes aware of and responds to Streptococcu...
A: Innate immunity is well known term that is usually defined as the first non-specific immunological t...
Step by step
Solved in 2 steps