Q: What are the three phases of hepatitis viral infection?
A: Hepatitis caused by a viral infection damages and inflames the liver. Hepatitis is brought on by a…
Q: Planaria are able to regenerate after they are cut in half. Answer the three questions to explain…
A: A planarian can be divided into pieces, and each piece has the ability to grow back into a full…
Q: Julie (a female) has hemophilia. Based on this information, what can we say about the genotypes of…
A: Introduction X-linked diseases are those that occur due to the presence of abnormal/ diseased…
Q: What step in the scientific method follows experimentation?
A: Introduction The scientific method of research is a process that involves various steps of…
Q: Which of the following statements about hormones and nerve impulses is accurate? O A. Hormones and…
A: Introduction Neurons are specialized for receiving and sending electrical impulses throughout the…
Q: Explain the importance of Document Control and Records Management in the clinical laboratory. Give…
A: Medical devices can also function as "bridges" (as in cardiac assist, pulmonary assist, and renal…
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: 16 Which of the following correctly identifies a part of the human ear and its function? A. B. C. D…
A: Introduction : The cochlea is a long, coiled outgrowth of sacculus. It is the primary organ of…
Q: Match the description with the correct term. A. the idea that inherent variation in a population…
A: Evolutionary biology is the science of how evolution happens. Evolution is the mechanism of…
Q: design a analog of dna intercalator which has electrostatic interactions with DNA and crosslinks…
A: DNA intercalators are aromatic compounds designed to have a close semblance to the base pair's ring…
Q: Consider the steps involved in an experiment that uses the scientific method. Arrange the six given…
A: Scientific method is the systematic way of doing experimnet
Q: In animals, nitrogenous wastes are produced mostly from the catabolism of [Blank]. Question 6…
A: Nitrogenous discharges are the nitrogen compounds that organisms produce to expel extra nitrogen.…
Q: In the life cycle of a bryophyte, the sporophyte is nutritionally Dependent or Independent (circl…
A: Introduction Small, non-vascular plants known as bryophytes include mosses, liverworts, and…
Q: What is the function of hepatocytes?
A: Introduction The liver is the largest gland in the body and plays various important roles in human…
Q: Calculate the melting temperature of this primer and estimate the annealing temperature of this…
A: Introduction PCR (polymerase Chain Reaction) is a molecular technique by which multiple copies of…
Q: 2. Why are images observed under the microscope inverted and reversed?
A: Introduction Microbiology is the study of microorganisms, which are unicellular or cell-cluster…
Q: According to the graphical theory of life history evolution, describe the shape of the trade-off…
A: A group of creatures that can breed with one another in nature and create healthy offspring is…
Q: Glycolysis, which can occur in all living cells, correctly occurs in the cell structure _____, and…
A: Glycolysis is also known as EMP pathway (Embden - Meyerhof Pathway). It is a universal process. It…
Q: List three major steps that are hypothesized to have occurred in the evolutionary history of…
A: Photosynthesis occurs in plants and some green algae. This occurs due to the presence of chlorophyll…
Q: Rank the relative size of the gametophyte generation in the following plant lineages: Bryophyte…
A: Plants show alternation of generation where they complete their life cycle in two phases - a diploid…
Q: Explain how the different glands work together to maintain homeostasis
A: Homeostasis is any self-regulating process by which an organism maintains stability while adjusting…
Q: o (8) a. Which one of the following phenomena is responsible for transportation of food through…
A: Cell is the smallest functional and structural unit of life. Each cell perform their specific…
Q: In a 50 square mile section of forest, there are some cut patches of forest where the trees have…
A: A scientific method is a systematic approach to a scientific study. It was developed in the 17th…
Q: 1.4 If galangin were tested, how would its antibacterial activity compare to that of the other…
A: Flavanoids are commonly seen in the plant kingdom and they are heterocyclic compounds. They can be…
Q: 6. You are investigating the contents of three weird aliens. You want to see which biomolecules the…
A: Introduction Biomolecules are substances that are naturally produced by living cells. Mainly there…
Q: 1. For each of the diploid genotypes presented below, determine the genetic make up for all of the…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: he Krebs cycle occurs in the Select one:
A: The Krebs cycle or TCA cycle (tricarboxylic acid cycle) or the Citric acid cycle is a sequence of…
Q: How do pancreatic beta cells differ from acinar cells?
A: Pancreatic beta cells are present in the core of the islet. Beta cells are endocrine cells that…
Q: Write a short paragraph about Mulberry Branches and Their Biological Properties
A: Introduction The genus Morus, which includes numerous species of deciduous trees generally known as…
Q: The tetrapeptide Cys-Trp-Lys-Pro was digested with chymotrypsin and adjusted to pH=0.5 to fully…
A: Each protein or peptide is made up of a linear sequence of amino acids. The primary structure of a…
Q: Bacteria are _in comparison to eukaryotic cells.
A: Introduction The cells are the fundamental units of all living things. There are billions of cells…
Q: The following diagram shows two pairs of homologous chromosomes. One pair of homologous chromosomes…
A: The sexually reproducing organisms produce gammates that are the unit of sexual reproduction. The…
Q: A medical imaging facility is considering the purchase of a positron emission tomography (PET) or a…
A: Mutual exclusivity can be defined as a phenomenon in which two things taken into consideration…
Q: biotechnology: -define biotechnology -list 10 products of biotech found in our home
A: Q. Define biotechnology Q. list 10 products of biotech found in our home
Q: Why is a theory more comprehensive than a conclusion?
A: Introduction Scientific method is the process of systematizing and extending the understanding of…
Q: Using your fingers, you are asked to aseptically touch the surface of a sterile agar plate.…
A: The aseptic technique of plating on an agar plate means that a sterile or no infection-containing…
Q: Despite CAM photosynthesis having a comparatively higher water use efficiency relative to C3 and C4…
A: CAM pathway is adapted in plants to perform photosynthesis under stress. The CAM pathway reduces…
Q: Explain why a complete atom is electricallyneutral.
A: An atom is the smallest unit of body organisation. Several atoms get united to form molecules and…
Q: Rubisco is present in the Calvin Cycle in C4 photosynthesis True False
A: C4 photosynthesis also called dicarboxylic acid pathway is a mode of photosynthesis found in a…
Q: The picture shows the different stages in the life of a pea plant. Which characteristic of living…
A: Introduction A plant is a living organism of the type represented by trees, shrubs, herbs, grasses,…
Q: Describe the defect in intussusception.
A: Introduction The human digestive system comprises the alimentary canal and associated digestive…
Q: Each level of biological organization has emergent properties that arise from the interaction of its…
A: Emergent properties are those that arise from the interaction of component parts. In biology,…
Q: In some organisms, asexual reproduction can occur from just a fragment of the parent organism,…
A: Asexual reproduction is a type of reproduction in which new offsprings are produced from a single…
Q: You start your 8-4 pm shift and review the quality control levy jennings chart results from the…
A: Introduction : Quality control data is shown on a graph called a Levey-Jennings chart to provide a…
Q: II. CELL FEATURE OBSERVATION The following questions pertains to the features of cells. Provide the…
A: Cell is the structural and functional unit of all the individual both unicellular as well as…
Q: Compare the cause and presentation of impetigo and staphylococcal scalded-skin syndrome.
A: Impetigo and Staphylococcal scaled-skin syndrome is caused by Staphylococcus aureus. These two…
Q: Name four process controls and their importance. (related to medical laboratory)
A: Introduction : Process control is the statistical regulation of the process within the upper and…
Q: Which of the following describes the effect of the venom on the prey of the cobra?
A: Introduction Muscle contraction is a result of action potential generated by depolarization,…
Q: What has been successful in previous attempts for weight loss?
A: Being overweight has an adverse impact on the health of a person as it can invite various diseases…
Q: i. Tabulate the parts and functions of the microscope
A: Introduction A laboratory tool called a microscope is used to examine specimens that are too small…
How do the skin blood vessels and sweat glands regulate body temperature?
Step by step
Solved in 2 steps
- When our body temperature rises above 37°C or 98°F, a negative feedback mechanism will be triggered to lower the body temperature. As a result, our sweat glands release sweat to cool the body temperature. Which part of the negative feedback mechanism is the sweat gland? A) effector B) receptor C) stimulus D) control center stimulus effector control center receptorHow do heater organs produce heat?Why do you think there is a change in body temperature, color change and perspiration level? In what ways does your body attempt to maintain homeostasis?
- Your body feels very warm after exercising. What has happened?When body temperature becomes elevated, two things happen in the skin to help cool the body. Identify these two processes and how they help decrease body temperature.(a)What are the stimuli in the picture? (b) What is our body’s response when the temperature of our body decreases? When it increases?
- What process allows us to adjust to either extreme heat or extreme cold?Sketch a new graph to show how body temperature changes over time. Just like this: 20 10 time (hours) room temperature ("C)2) to cool the body, sweat evaporates from the skin and ........ a) heart rate increases b) blood vessels dilate c) blood vessels constrict d) adipose tissue expands