give uipac name

Q: An unknown compound has the following chemical formula: N₂O where x stands for a whole number.…

A: Given : NxO

Q: References Submit Answer Use the References to access important values if needed for this question.…

A: 0.102 mol of KOH is added to 1.00 L of a buffer solution that is made up of 0.372 M HClO and 0.373…

Q: متعدد الخيارات Calculate the molecular weight for) (CaC204 Ca=40, C=12, 0=16 128g/mol 124g/mol m/mol…

A: Molecular weight calculated as follows

Q: Discuss the reasons for the differences in glass transition temperature for the following pairs of…

A: As we can see that the transition temperature for Poly(vinyl alcohol) (85°C) is greater than…

Q: 2.5 Polymer/Filler Interface and Mechanical Properties Talk in general about the influence of…

A: A series of composites that may be based on the low and high density polyethylene matrices with…

Q: The figure below shows TEM micrograph of a rubber toughened polystyrene (PS) orthotic (i.e. rubber…

A: Diffrential scanning calorimetry: Differential scanning calorimetry is a technique in which the…

Q: gma Sand Sigma Shale Sigma Hydrocarbon Shale volume, Vsh Porosity 6 cu 30 cu 20 cu 10% 25 pu…

A:

Q: (50ml) (0.05000) = (1000 ppm) (?) tem (50ml) (0.7500)= (1000 ppm) (?) PPM SomL) (1.000) = (1000ppm)…

A: The equation given is :, This equation depicts the dilution equation where a diluted solution is…

Q: The magnetic moment of divalent ion in aqueous solution if its atomic number 25 is

A:

Q: Measured values at present indicate that the chain. . of polyethylene can be higher than 280 GPa.

A: Measured values at present indicate that the chain modulus of polyethylene is certainly higher than…

Q: What adsorbents are typically used in TLC? On a TLC, a compound traveled 3.5 cm when the solvent…

A: Thin layer chromatography is the technique that is used to separate or purify the compound from a…

Q: In the space provided in the back, draw ALL the ionization (or protonation) states of the following…

A: If the pH is greater than pKa then deprotonation occurs and it exists in deprotonation form.  while…

Q: Part A At what pH will the following tripeptide have this structure? H2N-CH %23 CH CH- CH2 CH2 CH2…

A: The above mentioned question is explained below :

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Consider 8.5 kg of austenite containing 0.52 wt% C, cooled to below 727'C (1341'F). (a) What is the…

A: Given that, 8.5 kg of austenite containing 0.52wt% C, cooled to below 727°C (1341°F).

Q: Steam reforming of methane (CH) produces "synthesis gas," a mixture of carbon monoxide gas and…

A:

Q: 3 compounds with elements from groups 2A and 5A

A: 2A group is alkaline earth metal and 5A group is nitrogen family . Let form compound by reacting…

Q: With respect to the monomers and the subsequent molecular structures, select all correct…

A: A multiple choice question based on polymer chemistry, which is to be accomplished.

Q: Strain 0.4 0.7 1.2 2.5 Stress (Pa) 360000 830000 1200000 2500000 What is the average molecular…

A: Average molecular weight of chain lengthMw = N1M12+N2M22+N3M32+. . . .N1M1 + N1M2 + N3M3 + ....

Q: 3. The 1H NMR and the IR spectra of compound A are shown below. In the mass spectrum the parent ion…

A: Molecular formula of A = C10H12O2

Q: Discuss the reasons for the differences in glass transition temperature for the following pairs of…

A: Discussion of the reasons for the difference in glass transition temperature of the polyethylene and…

Q: OH CrO 3 HO NaNH, H₂, Pt 2 NaNH,

A: In PCC reaction, the primary alcohol (starting reactant) is oxidised to aldehyde in the presence of…

Q: What is the expected product from the reaction sequence shown? 1. NaN3 2. LIAIH4 3. H20 HDJCMD NHNH2…

A: Option last one should be the correct answer. The follow up for this reaction goes as

Q: Which protein folding interaction is / are most likely to occur on the outside of a protein pocket…

A: The major contributors to protein folding interaction involves the hydrophobic effect, hydrogen…

Q: G) The bolling range of Wax more than 500 °C and less than 600 °C. H) Desalting process cause…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: Calculate the number average molecular weight corresponding to the molecular weight distribution for…

A: Given, Polydispersity index=1.25 To calculate, Number average molecular weight, Mn Polydispersity…

Q: X: reproduce the interatomic interactions Y: define a computable energy (such as Gibb's free energy)…

A: The complete structure of a protein can be divided into 4 based on the complexity: primary,…

Q: Volume Identity Volume Volum of acid of base of base e of water needed for dilution Target pH…

A: The Henderson-Hasselbalch equation for buffers: pH = pKa + log [salt] / [acid] Considering that the…

Q: Which of the following amino acids contain nonpolar side chains? Select all that apply. A. Serine B.…

A: Amino acids are the building blocks of proteins and have unique properties that contribute to the…

Q: (b) TABLE 3 shows data phase equilibrium diagram for carbon dioxide. TABLE 3 Pressure (atm) 5.2…

A:

Q: Problem 1: Write down (a) the Bravais lattice and (b) basis (per primitive unit cell) of crystal…

A: Bravais lattice Structure is useful for determining crystal structure. It refers to 14 different 3…

Q: ation.com/ext/map/index.html?_con%3Dcon&external_browser%3D08launchUrl%3https%253A%252F%252Fatlantat…

A: We know that  pi bonds are covalent chemical bonds where two lobes of an orbital on one atom overlap…

Q: Polymorphism of macromolecules like polypropylene show multiple crystal structures from monoclinic…

A: While many polymers can exhibit various crystalline structures, not all of them have distinct…

Q: Predict the products of the following reaction. If no reaction will occur, use the NO REACTION…

A:

Q: Liquid X is known to have a lower viscosity and lower vapor pressure than Liquid Y. Use these facts…

A: Viscosity is a degree of a fluid's resistance to flow, whereas vapor pressure is a sign of a…

Q: Temperature (°C) 1600 1400 1200 1000 800 600 1538°C 400 0 (Fe) 912°C (+? -1493°C 1394°C y. Austenite…

A: a)CFe3C- C weight % of ferrite C0- 0.76 wt.% of carbon Ca- 0.022 wt.% of carbon The lever rule…

Q: Blast furnaces extra pure iron from the iron(III) oxide in iron ore in a two step sequence. In the…

A: Answer:This problem is based on stoichiometric calculation where by using stoichiometric…

Q: Which of the following statements are correct about the process of protein structure determination…

A: Proteins are the building blocks of life which are composed of amino acids and these are arranged…

Q: TABLE 2.2 Glass Transition and Melting Temperatures of Some Polymers Polymer T, (°C) T. (°C)…

A: In the table, different polymers and data of , and are given.A ratio was calculated from Tm and Tg…

Q: (02ME Licl, He0, OMso ? 130°c CO2Me (9) (6) (5) .co2me on 40

A: We have given the organic reaction and we have to find the major product of the reaction.

Q: A unidirectional carbon-fiber-epoxy-resin composite consists 65% by volume of carbon-fiber and 35%…

A: To calculate the weight percentages of carbon-fiber and epoxy-resin in the composite, we will use…

Q: A crosslinked copolymer consists of 59 wt% ethylene (C2H4) repeat units and 41 wt% propylene (C3H6)…

A: Since the weight % is given and we need mole % to find the fraction. Assuming we have 100 gm of…

Q: Draw the structure of the tripeptide, Asp-Lys-Ser, and determine its pl value.

A: Isoelectric point: The pH at which The net electric charge of the protein or peptide or an amino…

Q: Polymeric composite materials can be obtained by adding fillers in the form of particles or fibers…

A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: (c) 5.909 kg of monomer A were copolymerized with 5.306 kg of monomer B. Ph NC A В Assuming that the…

A: A question based on polymer that is to be accomplished.

Q: www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-lgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9QIn2eRVQ-…

A: Step 1: Step 2: Step 3: Step 4:

Q: Electrostatic charges can also be produced on the surfaces of polymeric materials due to: *…

A: 1)low surface conductivity of most polymeric materials 2)ionizes antistatic agent in the presence of…

Micelles and Biological Membrane

Micelles are the type of lipid molecules that organize themselves in spherical shape in aqueous solutions. The production of the micelle is a reply to the amphipathic behavior of fatty acids. It means that they consist of both hydrophobic regions and hydrophilic regions. In micelles, polar head groups (hydrophilic groups) produce an outer layer associated with water whereas nonpolar tails (hydrophobic groups) are organized in the interior.