give uipac name 1д2345H₂C-CH₂-in₂ - CH₂ - CH₂еноIng - -ін-сиHC-32 ЧСНу-Сиз спосднуть- -CH=C-CH5 61,in7Ьвсн.3си сизсизсисиз829

The given compound is a hydrocarbon, alkane. The IUPAC name of an alkane can be written on the basis…

Answered: give uipac name

Science

Chemistry

give uipac name

Chemistry

10th Edition

ISBN:9781305957404

Author:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Publisher:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Chapter1: Chemical Foundations

Section: Chapter Questions

Problem 1RQ: Define and explain the differences between the following terms. a. law and theory b. theory and...

See similar textbooks

Related questions

Q: Bu₂CuLi +

A: Given reactants are Gilman reagent and alkyl iodide.Gilman reagent is organometallic reagent…

Q: An unknown compound has the following chemical formula: N₂O where x stands for a whole number.…

A: Given : NxO

Q: متعدد الخيارات Calculate the molecular weight for) (CaC204 Ca=40, C=12, 0=16 128g/mol 124g/mol m/mol…

A: Molecular weight calculated as follows

Q: Discuss the reasons for the differences in glass transition temperature for the following pairs of…

A: As we can see that the transition temperature for Poly(vinyl alcohol) (85°C) is greater than…

Q: 2.5 Polymer/Filler Interface and Mechanical Properties Talk in general about the influence of…

A: A series of composites that may be based on the low and high density polyethylene matrices with…

Q: The figure below shows TEM micrograph of a rubber toughened polystyrene (PS) orthotic (i.e. rubber…

A: Diffrential scanning calorimetry: Differential scanning calorimetry is a technique in which the…

Q: gma Sand Sigma Shale Sigma Hydrocarbon Shale volume, Vsh Porosity 6 cu 30 cu 20 cu 10% 25 pu…

Q: (50ml) (0.05000) = (1000 ppm) (?) tem (50ml) (0.7500)= (1000 ppm) (?) PPM SomL) (1.000) = (1000ppm)…

A: The equation given is :, This equation depicts the dilution equation where a diluted solution is…

Q: The magnetic moment of divalent ion in aqueous solution if its atomic number 25 is

Q: Measured values at present indicate that the chain. . of polyethylene can be higher than 280 GPa.

A: Measured values at present indicate that the chain modulus of polyethylene is certainly higher than…

Q: 1. Poly (tetrafluoroethylene) (Teflon) will have a higher glass transition temperature, Tg than Poly…

A: A question about glass transition temperature, which is to be accomplished.

Q: In the space provided in the back, draw ALL the ionization (or protonation) states of the following…

A: If the pH is greater than pKa then deprotonation occurs and it exists in deprotonation form. while…

Q: Part A At what pH will the following tripeptide have this structure? H2N-CH %23 CH CH- CH2 CH2 CH2…

A: The above mentioned question is explained below :

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Consider 8.5 kg of austenite containing 0.52 wt% C, cooled to below 727'C (1341'F). (a) What is the…

A: Given that, 8.5 kg of austenite containing 0.52wt% C, cooled to below 727°C (1341°F).

Q: 3 compounds with elements from groups 2A and 5A

A: 2A group is alkaline earth metal and 5A group is nitrogen family . Let form compound by reacting…

Q: With respect to the monomers and the subsequent molecular structures, select all correct…

A: A multiple choice question based on polymer chemistry, which is to be accomplished.

Q: 3. The 1H NMR and the IR spectra of compound A are shown below. In the mass spectrum the parent ion…

A: Molecular formula of A = C10H12O2

Q: Discuss the reasons for the differences in glass transition temperature for the following pairs of…

A: Discussion of the reasons for the difference in glass transition temperature of the polyethylene and…

Q: Which protein folding interaction is / are most likely to occur on the outside of a protein pocket…

A: The major contributors to protein folding interaction involves the hydrophobic effect, hydrogen…

Q: G) The bolling range of Wax more than 500 °C and less than 600 °C. H) Desalting process cause…

A: Since you have posted a question with multiple sub-parts, we will solve first three subparts for…

Q: Calculate the number average molecular weight corresponding to the molecular weight distribution for…

A: Given, Polydispersity index=1.25 To calculate, Number average molecular weight, Mn Polydispersity…

Q: X: reproduce the interatomic interactions Y: define a computable energy (such as Gibb's free energy)…

A: The complete structure of a protein can be divided into 4 based on the complexity: primary,…

Q: Which of the following amino acids contain nonpolar side chains? Select all that apply. A. Serine B.…

A: Amino acids are the building blocks of proteins and have unique properties that contribute to the…

Q: (b) TABLE 3 shows data phase equilibrium diagram for carbon dioxide. TABLE 3 Pressure (atm) 5.2…

Q: Problem 1: Write down (a) the Bravais lattice and (b) basis (per primitive unit cell) of crystal…

A: Bravais lattice Structure is useful for determining crystal structure. It refers to 14 different 3…

Q: ation.com/ext/map/index.html?_con%3Dcon&external_browser%3D08launchUrl%3https%253A%252F%252Fatlantat…

A: We know that pi bonds are covalent chemical bonds where two lobes of an orbital on one atom overlap…

Q: 6.) An unknown polymer sample is fractionated, and the following molar fractions are obtained.…

A: Polymers are large molecules formed by the chemical linkage of repeated small units…

Q: 4. Metallurgy in the Auto Industry The following illustration appeared in a newspaper article (New…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…

Q: Polymorphism of macromolecules like polypropylene show multiple crystal structures from monoclinic…

A: While many polymers can exhibit various crystalline structures, not all of them have distinct…

Q: 47:53 1/858 0.10 A 5-year $1000 par - value bond makes annual payments and sells at a price of…

A: Bond Price = Coupon Payment*((1-((1+r)^-n))/r)+Face Value/(1+r)^n 1200 = Coupon…

Q: Liquid X is known to have a lower viscosity and lower vapor pressure than Liquid Y. Use these facts…

A: Viscosity is a degree of a fluid's resistance to flow, whereas vapor pressure is a sign of a…

Q: 1) ----- gives properties of erystalline solids so they dominate the material properties. 2) Crystal…

A: As per the guideline, since you have asked multiple question, we have solved the first question for…

Q: Temperature (°C) 1600 1400 1200 1000 800 600 1538°C 400 0 (Fe) 912°C (+? -1493°C 1394°C y. Austenite…

A: a)CFe3C- C weight % of ferrite C0- 0.76 wt.% of carbon Ca- 0.022 wt.% of carbon The lever rule…

Q: Blast furnaces extra pure iron from the iron(III) oxide in iron ore in a two step sequence. In the…

A: Answer:This problem is based on stoichiometric calculation where by using stoichiometric…

Q: You need a digestion buffer consisting of the following: / Jy moet 'n verteringsbuffer op maak wat…

Q: Which of the following statements are correct about the process of protein structure determination…

A: Proteins are the building blocks of life which are composed of amino acids and these are arranged…

Q: TABLE 2.2 Glass Transition and Melting Temperatures of Some Polymers Polymer T, (°C) T. (°C)…

A: In the table, different polymers and data of , and are given.A ratio was calculated from Tm and Tg…

Q: A crosslinked copolymer consists of 59 wt% ethylene (C2H4) repeat units and 41 wt% propylene (C3H6)…

A: Since the weight % is given and we need mole % to find the fraction. Assuming we have 100 gm of…

Q: if a lower polydispersity us desired, which would be more acceptable?

Q: Aqueous sulfurlc acid (H,SO will react with solld sodlum hydroxide (NaOH) to produce aqueous sodlum…

A: The balanced chemical equation can be written as follows: H2SO4 + 2 NaOH --> Na2SO4 + 2 H2O 1 mol…

Q: Draw the structure of the tripeptide, Asp-Lys-Ser, and determine its pl value.

A: Isoelectric point: The pH at which The net electric charge of the protein or peptide or an amino…

Q: Polymeric composite materials can be obtained by adding fillers in the form of particles or fibers…

A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: (c) 5.909 kg of monomer A were copolymerized with 5.306 kg of monomer B. Ph NC A В Assuming that the…

A: A question based on polymer that is to be accomplished.

Q: www-awu.aleks.com/alekscgi/x/Isl.exe/10_u-lgNslkr7j8P3JH-IQUHIQg6bJxmeSyVPHOEB1plef9xyC5Ca9QIn2eRVQ-…

A: Step 1: Step 2: Step 3: Step 4:

Concept explainers

Micelles and Biological Membrane

Micelles are the type of lipid molecules that organize themselves in spherical shape in aqueous solutions. The production of the micelle is a reply to the amphipathic behavior of fatty acids. It means that they consist of both hydrophobic regions and hydrophilic regions. In micelles, polar head groups (hydrophilic groups) produce an outer layer associated with water whereas nonpolar tails (hydrophobic groups) are organized in the interior.

Question

give uipac name

1
д
2
3
4
5
H₂C-CH₂-in₂ - CH₂ - CH₂
ено
I
ng - -
ін-си
HC-
32 Ч
СНу-Сиз спос
днуть
- -
CH=C-CH
5 61,
in
7
Ь
в
сн.
3
си сиз
сиз
сисиз
82
9

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.

Similar questions

Electrostatic charges can also be produced on the surfaces of polymeric materials due to: -Lowering the surface resistance of polymeric materials -Low surface conductivity of most polymeric materials -Repeated deformations and friction occurs on the polymeric materials Conduction channels formed on the surface of plastics due to: * -Hygroscopic nature of antistatic agent -Impurities adsorbed from the air moisture -lonizes antistatic agent in the presence of water ESO shows poor migration stability when used in a large amount with PVC due to: * -Ability to bind hydrogen chloride -Convert unreacted double bonds epoxide groups -Incompatibility with PVC matrix
Please provide correct answer
Part B Gold has a face-centered cubic arrangement with a unit cell edge length of 4.08 A . How many moles of gold fit in a gold nanoparticle sheet with a length of 60.1 nm, a width of 20.7 nm , and a thickness of 7.66 nm ? Express your answer with the appropriate units. > View Available Hint(s) µA Value Units Submit < Return to Assignment Provide Feedback Pearson son Education Inc. All rights reserved. | Terms of Use | Privacy Policy | Permissions | Contact Us | Show All utlin..pdf MacBook Air DII DD F12 F11 F10 F8 F7 ( ) & 7 8 9 } P Y 11 + ||
(a) Compute the repeat unit molecular weight of polybutene unit chemical formula =( C8H16) (b) Compute the number-average molecular weight for a polybutene for which the degree of polymerization is 24,000.
The composition in mole fraction units of the strands of a double-helical DNA is [A]= 0.30 and [G] = 0.24. A) What can you say about [T] and [C] for the same strand? B) What can you say about [A], [G], [T] and [C] of the complementary strand?
The number-average molecular weight of a poly(acrylonitrile-isoprene) copolymer is 15,000 g/mol with 34wt% of isoprene repeat unit (Acrylonitrile = C3H³N; Isoprene = C5Hg). For each molecule of this copolymer, what is the average number of repeat units of: Acrylonitrile: ✔ [ Select] 93.4 96.2 104.4 186.6 Isoprene: [
typing
Kindly include solutions and explanations.
Please don't provide handwritten solution ....
ne File Edit View History Bookmarks Profiles Tab Evolution of the Genome-Cell X Significant Figures Counter E esc X Mathway | Algebra Problem So x A ALEKS-Lara Althawadi - Lear X C www-awu.aleks.com/alekscgi/x/lsl.exe/1o_u-IgNslkr7j8P3jH-IvTqeviKFP6W0cqJcWJdIACROQwyw24GWHInqCmj000aolPZo5oqa7WgLOML1yaFz8E-CEGkqhv... solution Form M Gmail OKINETICS AND EQUILIBRIUM Setting up a reaction table initial change equilibrium G hess law organic c.... YouTube Maps Suppose a 250. mL flask is filled with 0.80 mol of H₂ and 0.90 mol of NH₂. This reaction becomes possible: N₂(g) + 3H₂(g)2NH, (g) Complete the table below, so that it lists the initial molarity of each compound, the change in molarity of each compound due to the reaction, and the equilibrium molarity of each compound after the reaction has come to equilibrium. Use x to stand for the unknown change in the molarity of N₂. You can leave out the M symbol for molarity. Explanation CA 17,306 N₂ 0 X 0 Check 3 Tab Window Help H₂ 0 0 9 NH, 0 0 0…
What is the instrumentation of Conductometry ?
4) You are stranded and have two plastic jugs, you decide to burn one of the jugs to to send smoke signals and to keep yourself warm, and you decide to save the other jug to carry and store water. One jug is made out of polyvinyl chloride (PVC) and one is made out of polypropylene (PP). Which jug do you choose to burn and why? Combustion of PVC Combustion of PP AHFPVC = 29.6 kJ/mole C₂H3Cl(g) + O₂(g) → CO₂(g) + H₂O(g) + HCl(g) C3H6(g) + O2(g) → CO₂(g) + H₂O(g) AHFPP = 20.6 kJ/mole