For you, what is the contribution around 18-1900 of golden era in biochemistry? Explain
Q: QUESTION 5 Using SP-Sepharose as ion exhange resin, indicate the starting and ending pH for the…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Match lipid descriptions in column A with the phospholipid types in column B. H is attached to the…
A: Phospholipids are found in the membrane. Their structure comprises of polar head group &…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Allosteric enzymes are the Enzymes that possess allosteric sites at which inhibitor or activator…
Q: COMPLETE THE TABLE OF 10 STEP OF GLYCOLYSIS BY REFERRING TO THE GLYCOLYSIS PATHWAY
A: The chemica; interconversion steps, that is the sequence of reaction by which glucose is converted…
Q: Given Poly-L-Lysine and Epsilon Poly-L-Lysine, which polymer(s) can easily dissolve in a saline…
A: Poly-L-Lysine are several types of lysine as homopolymers.Poly-Lysine enhances electrostatic…
Q: Question 4 Match the each enzyme deficiency with their corresponding disease B-hexosaminidase A A.…
A: Enzyme deficiency results in certain metabolic disorders and results in serious diseases.
Q: 2. ( To the right is a schematic diagram of His the active site in the Michaelis complex of a-chy-…
A: Chymotrypsin is a protease that cleaves a peptide at the C-terminal of all aromatic amino acid.…
Q: Which of the following statements regarding the structure of DNA inside cells is NOT correct? A.…
A: DNA : Double helix A: Adenine G: Guanine T: Thymine C : Cytosine
Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…
A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…
Q: Given ohationg im which is a Jlist of orgamelles ņ mitochondira, endopla smic rediculerm,pesoxisomes…
A: A cell is composed of a cell membrane, cytoplasm, and cellular organelles in the cytoplasm.…
Q: Which of the following is the primary method by which cyclin proteins are regulated to influence…
A: A. Transcriptional upregulation and translation followed by targeted ubiquitin-mediated degradation…
Q: The picture below shows the body's response to acute stress, which is to release adrenaline…
A: Introduction: Adrenergic neurons release norepinephrine as the primary neurotransmitter. These…
Q: In the Biuret Assay for protein concentration determination, the role of sodium potassium tartrate…
A: The biuret test is a chemical test that can be performed to determine whether an analyte has peptide…
Q: Gluconeogenesis in the liver is When blood glucose levels are low, glucagon is secreted from the…
A: Blood is defined as the type of constant circulating fluid that play a major role in carrying…
Q: In electron transport c Select one: О a. 1 АТР O b. 2ATP Ос. ЗАТР O d. None of the abe
A: Metabolism includes biosynthesis/ reduction (an anabolic process) and oxidation (catabolic…
Q: reaction
A: Hess law is mainly used to find out specific unknown enthalpy change. It is particularly useful for…
Q: Match the following biogeochemical cycles terms to the correct definiton. In this cycle the…
A: Introduction: The term biogeochemical cycle is a natural process that recycles nutrients from the…
Q: A polypeptide is shown below. Please answer the following questions. OH В A C H;N E H D H a. Match…
A: A polypeptide is a long, unbranched chain of amino acids joined by peptide bonds. To generate an…
Q: Identify the ff nucleic acid bases and then classify whether it is a purine or pyrimidine.
A: Nucleic acids are also known as polynucleotides. Monomeric units of nucleic acids are called…
Q: Substrate A occupies the active site of an enzyme. However, inhibitor XY occupies a region in the…
A: Enzymes are catalyst which only accelarate the reactions but doesn't take part in reaction. So after…
Q: uan used the ABO blood testing kit to determine his blood type. His test showed the following…
A: ABO blood grouping in humans: The RBCs of the one with blood group A have antigen A and the plasma…
Q: Describe how you would make 10mls of a solution with concentration: 10mM Glucose (MW-180.16g/mole)…
A: In a solution concentration of solute is reduced simply by mixing more water or by adding more…
Q: Identify the 4 steps of gluconeoegenesis that are different from glycoslysis. Write the reactants,…
A: Gluconeogenesis (GNG) is a metabolic pathway that results in the generation of glucose from certain…
Q: *Which of the following statements about allosteric enzymes is NOT true? Question 10 options: - They…
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. Allosteric enzymes are…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: 7. Specific gravity of lipid is . 0.2
A: A biological membrane has lipids as an essential component. It includes phospholipids…
Q: Explain when "formulated media" was chosen to be used as a medium in the fermentation process?…
A: A growth medium, also known as a culture media, is a solid, liquid, or semi-solid that is used to…
Q: 18:3CA9,12,15
A: Alpha Linolenic acid is essential fatty acid, highly concentrated in plant oils. Essential fatty…
Q: Match the following descriptions to the given choices.…
A: A lipid is a biomolecules which include fats, waxes, oils, hormones, and certain components of…
Q: AP is a 35-yr old male presents with hypertension. His medications were known to work by inhibiting…
A: Any of several naturally occurring amines that act as neurotransmitters and hormones in the body is…
Q: KOH required to neutralize fatty acid present in 1 g
A: Some alkali bases, such as potassium hydroxide KOH, combine with fatty acids, lipids, or oil…
Q: 8/9 Instructions; • Answer the Question properly and accordingly. • Do not copy here in Bartleby or…
A: Note : Hi ! Thank you for the question. We are authorized to answer one question at a time. Since…
Q: Describe in detail synaptic termination by enxymes and by reuptake
A: Introduction: Neurotransmitters are chemical messengers that transfer signals from a neuron to a…
Q: All these enzymes hydrolyze disaccharides in the small intestines EXCEPT O maltase O amylase O…
A: The main carbohydrate contained in our meals is sucrose, lactose, and starches. Cane sugar, milk,…
Q: These are enzymes that can sustain in a high hydrostatic pressure. * (Please choose one correct…
A: Bacteria are classified into different classes based on the influence of different environmental…
Q: Substrate 1 Site A Nonpolar Polar and neutral Polar and Site D Site B Polar and neutral Acidic…
A: Enzymes are usually composed of proteins and it catalyzes biochemical reactions in our body. It is…
Q: What is the dna strand sequence for phosphate sugar backbone?
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: The circulatory system is a O closed network of arteries, veins, and capillaries O an open network…
A: Circulatory system is one of the important systems of the body involved in various processes like,…
Q: How many activation cycles, Initiation cycles, Elongation cycles and termination cycles are needed…
A: Protein synthesis occurs in four main steps such as activation or charging of tRNA, initiation of…
Q: Both reducing monosaccharide and disaccharide give positive result in Barfoed's test. Which of the…
A: Barfoed's test is done to differentiate between monosaccharide and disaccharide.
Q: Which of the following statements is CORRECT regarding the following intermediate? H2N H NH2
A: "Since you have asked multiple questions, we will solve the first question for you. If you want a…
Q: Use the image below to determine what stage of the dog's life cycle is spent in the haploid state?…
A: Haploid stage is the condition at which cell contains only one set of chromosomes in its nucleus…
Q: When comparing two or more ligands, a larger numerical value for KD corresponds to a higher binding…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: Draw two diagrams, one showing what enzymes and products are produced when GLN is high and one when…
A: Gln in question stand for Glutamine. Glutamine is an amino-acid exist in L-form like other amino…
Q: Explain the biochemical consequences of ADA deficiency and explain them using the purine degradation…
A: The purine nucleotides are sequentially degraded by the removal of portions of nucleotides. The…
Q: Retroviruses, like the HIV, contain an enzyme called reverse transcriptase. Explain the flow of…
A: Introduction: In retrovirus, RNA is used as genetic material. It uses the enzyme…
Q: List the key challenges in the biosynthesis phosphatidylcholine.
A: The most common PL identified in circulating VLDL is phosphatidylcholine (PC) . PC is produced in…
Q: Fat storing cells of vertebrates are called hеpatocytes - asterocytes - adipocytes melanocytes
A: Lipids are easily soluble in nonpolar solvents such as benzene, ether, and…
Q: Lecithins and cephalins are both
A: Lecithin are mixture of glycerophospholipids like phosphatidylcholine, phosphatidylethanolamine,…
Q: How amylase is used/its purpose and why amylase useful in the food industry
A: Amylase are the Enzymes that can digest starch into small polymers of glucose units. They can…
Step by step
Solved in 2 steps
- What do you think is the golden contribution in the field of Biochemistry in the era of the 1800s and 1900s? Discuss.The relationship between DNA, RNA and Protein constitute the “central dogma of molecular biology”. Explain this statementThe One Gene One Enzyme Hypothesis (Beadle and Tatum, 1941) stated that each gene codes for a single enzyme. Summarize the advancements that have made the One Gene One Enzyme Hypothesis obsolete.
- what is the significance of famous dna structure experiment?So let’s review what we just did with a few questions: How important is nucleotide order to the process?Can DNA or other (organic) molecular level structures be programmed to do useful work? Obviously nature has done that but can it be done by engineers/bio-engineers.
- Contrast the contributions made to an understanding of transformation by Griffith and by Avery and his colleagues.Models of real-world phenomena can reveal important links between structure and function in biology. Describe how the structure of DNA revealed by theWatson and Crick model suggests how it functions in living things.Provide a brief discussion in support of the following statement: “RNA is believed to have played an important role during the origin of life.”