Related questions
Concept explainers
Fill the blank
New genes can arise during evolution through: (i) exon
shuffling, which can alter the domain structure of proteins;
(ii) duplication and divergence that generates gene families;
and (iii)_______ mutations in intergenic DNA sequences.
Evolution is the process by which population of organisms change over generations. Gene variation can arise from genetic mutation or genetic recombination. These variations alter gene activity or protein function, which can introduce different trait in an organism.
Mechanism of genome evolution includes gene and genome duplication, polyploidy, mutation rate, exon shuffling, pseudogenes etc.
Exon shuffling is an mechanism by which new genes are created. These can occur when two or more exons from different genes are combined together or when exons are duplicated. Exon shuffling result in new genes by altering the current intron-exon structure.
Gene duplication- It is process by which region of DNA coding for a gene is copied. It occur as a result of error in recombination or through retrotransposition event. This result in large number of mutation accumulated in duplicate gene.It plays a major role in evolution.
Divergence - Gene divergence is the process in which two or more population of an ancestral species,which are reproductively isolated, accumulate independent genetic change over time.
Intergenic DNA is a subset of non- coding DNA sequence located between genes that do not encode protein. These regions contain functionally important elements such as promoters and enhancers. Mutation in these region may affect expression of genes. Such mutations are called regulatory mutation.
Step by stepSolved in 3 steps
- Please use information from the text below and your knowledge of biology to answer the final two (2) questions. In 2003, as a result of the Human Genome Project, the complete sequence of all the bases in human DNA was released to the public. Although knowing the entire sequence of bases has proven valuable, scientists are currently working to map genes. Mapping genes involves determining the exact location of each gene. Since much of human DNA does not code for a protein, it is challenging to figure out which segments are actual genes. Often, scientists look at the percent composition of bases in a segment of DNA. If the segment of DNA has a large percentage of C and G bases (together over 50%), it is likely that it is a gene and codes for a protein. 9. A scientist analyzed the bases in a segment of DNA from a human skin cell to determine if it codes for a protein. The base A (Adenine) is 11% of the bases in this segment of DNA. Calculate the percentage of bases that would be C…arrow_forwardPlease use information from the text below and your knowledge of biology to answer the final two (2) questions. In 2003, as a result of the Human Genome Project, the complete sequence of all the bases in human DNA was released to the public. Although knowing the entire sequence of bases has proven valuable, scientists are currently working to map genes. Mapping genes involves determining the exact location of each gene. Since much of human DNA does not code for a protein, it is challenging to figure out which segments are actual genes. Often, scientists look at the percent composition of bases in a segment of DNA. If the segment of DNA has a large percentage of C and G bases (together over 50%), it is likely that it is a gene and codes for a protein. 10. Is it likely this segment of DNA codes for a protein? State 'yes' or 'no' AND support your answer using information from the text.arrow_forwardhttps://youtu.be/z9HIYjRRaDE?si=iysZqALCGUupgJlk Note: This video can also be found under the "What is evolution and how does it occur?" introduction tab in your lab module. You have already learned about how mutations can change the function of DNA and create new alleles. Write a short reflection (at least 5-6 sentences) connecting the main point of this video (that some mutations--such as duplicating a section of DNA--can lead to new genes) to your prior understanding of mutations from Life 102 lab. Focus on making connections and exploring your own thought processes. If you need help getting started, consider the following questions: •Did parts of the video reinforce or extend your understanding of mutations? How so? •Were there any parts of the video that were confusing to you or challenged your existing understanding of mutations? Why were those parts confusing or challenging? •What further questions do you have about mutations and the emergence of new genes as a result of…arrow_forward
- You are discussing with some of your bio major friends who have not taken Genetics and your non-bio major friends about how characteristics such as blue eye, light skin pigmentation, and light hair color, derived from a mutation that occurred about 10,000 years ago in Europe. Your friends are not very happy that you used the word mutation to describe the origin of human characteristics associated with light pigmentation. At that moment you only recall that green eye, fair skin and red hair in Neanderthals was due to other alleles and you mention that to them as an example of genetic determinants in species of the genus Homo. They are not convinced of your choice of the word mutation. Then you remember part of one of the papers that you read for Minicourse 5 regarding the OCA2 allele. “OCA2, homologous to the mouse pink-eyed dilution gene, encodes the human protein P, an integral membrane protein involved in both the transport of tyrosine and that helps in the regulation of…arrow_forwardConserved gene order observed in the chromosomes of two distantly related organisms provides evidence of a(n) _____ relationship between genes.arrow_forwardWhat are the answers to the following images and use evidence to support your answer?arrow_forward
- Many lethal genetic disorders such as CF, Huntington’s, sickle cell anemia, Tay Sach’s, etc., persist in the human genome. How have these genes survived so many millennia of evolution (why didn’t they die out)?arrow_forwardFill the blank Combinatorial strategies at the DNA level and RNA level,as well as __________ modifications of proteins,allow the production of highly diversified gene productseven from a single genearrow_forwardThe following are DNA sequences from two homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTA GTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do not begin and end at the same location. Try to line them up according to their homologous regions.arrow_forward
- How can you use this piece of information to help you explain to your friends what is the significance of mutations in the emergence of new genetic properties (alleles) that may result (or not) in new phenotypic characteristics? (Recall that not all SNPs affect phenotype.)arrow_forward________________________, but not ________________________ have genomes with a great deal of repetitive DNA that does not appear to encode functional genes.a) Prokaryotes, eukaryotesb) Eukaryotes, prokaryotesc) Mammals, reptilesd) Plants, animalse) Animals, plantsarrow_forwardSuppose a 10-year old patient has come to your office with a very rare disease. One so rare that only 100 people for the past 100 years have been diagnosed and nobody knows the gene or genes that are mutated in this disease. Describe the gene sequencing toold you would use to identify the mutated gene or genes in this hypothetical disease.arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning