explain this image for the ecoli bacteria mutation trpE

TACCCCGAGTCCCTGGCGTTAAAACAGTGCCGAATC

iii and iv

Please help a bit confused

Matching type Choices are in the picture   11. regulating elements in the operon 12. ribosome propels to the next bases 13. dozen of initiation factors involving methionly tRNA 14. eRF recognizes UGA 15. TATA box in the promoter region

Antibiotic X binds to the 50S ribosomal subunit of 70S ribosomes and blocks normal ribosomal function. Which of the following is true of this drug?     It would interfere with protein synthesis in bacteria, but not affect eukaryotic ribosomes.     It would interfere with peptidoglycan syntheis/repair in bacteria, but not affect eukaryotes as they lack peptidoglycan.     It would interfere with mRNA transcription in bacteria and in eukaryotes.     It would interfere with protein synthesis in bacteria and eukaryotes.     It would interfere with mRNA transcription in bacteria, but not affect eukaryotic transcription.     It would interfere with peptidoglycan syntheis/repair in bacteria, as well as in eukaryotes that possess cell walls.

me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…

What is the function of PRM?

Part A What kind of inhibition is imposed on HIV protease by ritonavir? O irreversible inhibition O reversible inhibition O uncompetitive inhibition. Submit Request Answer

Actinomycin D inhibits DNA-dependent RNA synthesis. Thisantibiotic is added to a bacterial culture where a specific proteinis being monitored. Compared to a control culture, whereno antibiotic is added, translation of the protein declines over a period of 20 minutes, until no further protein is made.Explain these results.