explain this image for the ecoli bacteria mutation trpE Trp operonPromoter(where RNA polymerase binds)Operator(where repressor binds)ChromosomeE. coli bacteriumtrp Etrp EĮtrpDtrpD↓trp CtrpCĮtrpBTranscriptiontrpB↓trpAtrpADNAmRNA↓ TranslationĮCEnzymes (& enzyme subunits) for tryptophan biosynthesis

Name: explain this image for the ecoli bacteria mutation trpE Trp operonProm
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: explain this image for the ecoli bacteria mutation trpE Trp operonPromoter(where RNA polymerase binds)Operator(where repressor binds)ChromosomeE. coli bacteriumtrp Etrp EĮtrpDtrpD↓trp CtrpCĮtrpBTranscriptiontrpB↓trpAtrpADNAmRNA↓ TranslationĮCEnzymes

Introduction The trp operon is a type of operon system found in E. coli bacteria. The trp operon…

Answered: explain this image for the ecoli…

Science

Biology

explain this image for the ecoli bacteria mutation trpE

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Create a metabolism cocept map using these terms RepressorInducer RiboswitchRepression InductionPositive regulationActivatorOperator Heat shocklac operontrp operon Catabolite RepressionHeat shocksigma-32 Negative regulationTwo-component regulationSensor Kinase Autoinducing Peptide (AIP)Response regulatorSigma factorsFeedback inhibitionProtein StabilityQuorum SensingRNA regulationAntisense RNAHomoserine Lactone (AHL)
The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′
The symbols a, b, and c in the table below represent theE. coli lac system genes for the repressor (I ), the operator(O) region, and the β-galactosidase (Z), although notnecessarily in that order. Furthermore, the order inwhich the symbols are written in the genotypes is notnecessarily the actual sequence in the lac operon.Activity (+) or inactivity (−) of Z geneGenotype Inducer absent Inducer presenta- b+ c+ + +a+ b+ c- + +a+ b- c- - a+ b- c+/a- b+ c- + +a+ b+ c+/a- b- c- - +a+ b+ c-/a- b- c+ - +a- b+ c+/a+ b- c- + +a. Which symbol (a, b, or c) represents each of the lacgenes I, O, and Z ?b. In the table, a superscript minus sign on a gene symbolmerely indicates a mutant, but some mutant behaviorsin this system are given special mutant designations.Using the conventional gene symbols for the lac operon,designate each genotype in the table.
that best fits the phrase below (1-20) Cis-acting B Post-transcriptional modification Post-translational modification Reactive (R) group Trans-acting C Operon Nuclear localizationsignal Double-stranded RIA Shine-Dalgarno sequence Kozak sequence E site on ribosome Ps p riboeE8R3) A site on ribosome Constitutive F Allosteric transition Inducer ll ol g Repressor T G H. Nonsense codon Frameshift mutation W Chaperones Found upstream of AUG codons in bacteria, this binds the 3' end of the 16S rRNA of the 30S ribosomal subunit Addition of chemical groups to amino acids in a polypeptide Hidigel elnw eesel Poly (A) polymerase enzyme uses ATP as substrate to add a string of A nucleotides on to the 3'-OH of MRNA Jeiheg 1ot eninoaso uoy nielgxe 10 anoitamusas Tuoy elsta otehgo1qqs eedW 4 Is produced when both strands of DNA encoding a gene are transcribed simultaneously A class of proteins that arrest incorrectly or incompletely folded proteins 6. Occurs when allolactose binds Lacl protein causing…
When referring to attenuation in the regulation of the trp operon it would be safe to say that, when there are high levels of tryptophan available to the organism, ________. tryptophan inactivates the repressor protein translation termination of the trp operon is likely the trp operon is transcribed at relatively high levels the ribosomes stall during translation of the attenuator region transcription termination at the attenuator region is likely
Match the following antibiotics with the drug strategy that would provide resistance to them. rifampin which blocks transcription [ Choose ] Choose] tetracycline which misaligns the beta-lactamase anticodon to its codon mutation of the TRNA binding site of the ribosome penicillin which blocks peptidoglycan creation of alternate metabolic pathway that ultimately leads to the same product synthesis mutation of RNA polymerase polymyxin which causes leakage in the porin which removes drug from periplasmic space cell membrane sulfonamide which inhibits enzyme of [Choose ] folic acid synthesis pathway Question 14 2 pts % & 5 7
Antibiotic X binds to the 50S ribosomal subunit of 70S ribosomes and blocks normal ribosomal function. Which of the following is true of this drug? It would interfere with protein synthesis in bacteria, but not affect eukaryotic ribosomes. It would interfere with peptidoglycan syntheis/repair in bacteria, but not affect eukaryotes as they lack peptidoglycan. It would interfere with mRNA transcription in bacteria and in eukaryotes. It would interfere with protein synthesis in bacteria and eukaryotes. It would interfere with mRNA transcription in bacteria, but not affect eukaryotic transcription. It would interfere with peptidoglycan syntheis/repair in bacteria, as well as in eukaryotes that possess cell walls.
me e File Content 911 Edit verview....pdf X PDF view Histor Biol 140 X Doordena Content acconline.austincc.edu/ultra/courses/_891351_1/cl/outline X Begin: X O Tutorial X Match each term with its best description. You may use each answer choice more than once. location of transcription in prokaryotes RNA triplet on tRNA which pairs complementary to an mRNA codon to ensure correct amino acid is brought into the ribosome during translation 18 Unit 3 X location of translation in all cells process of rewriting DNA code into mRNA code mRNA triplets which code for a specific amino acid Unit 3 ( x process of converting an mRNA transcript into a seuence of amino acids making up a polypeptide folded RNA that carries amino acids and transfers them to the ribosome during translation makes up ribosomes along with proteins location of transcription in eukaryotes intermediate between DNA and protein interpreted as codons specifying certain amino acids Content Your disk is alme Save space by op A.…
Antibiotics and Protein Synthesis Antibiotics are molecules produced by microorganisms as defense mechanisms. The most effective antibiotics work by interfering with essential biochemical or reproductive processes. Many antibiotics block or disrupt one or more stages in protein synthesis. Some of these are mentioned here. Tetracyclines are a family of chemically related compounds used to treat several types of bacterial infections. Tetracyclines interfere with the initiation of translation. The tetracycline molecule attaches to the small ribosomal subunit and prevents binding of the tRNA anticodon during initiation. Both eukaryotic and prokaryotic ribosomes are sensitive to the action of tetracycline, but this antibiotic cannot pass through the plasma membrane of eukaryotic cells. Because tetracycline can enter bacterial cells to inhibit protein synthesis, it will stop bacterial growth, helping the immune system fight the infection. Streptomycin is used in hospitals to treat serious bacterial infections. It binds to the small ribosomal subunit but does not prevent initiation or elongation; however, it does affect the efficiency of protein synthesis. Binding of streptomycin changes the way mRNA codons interact with the tRNA. As a result, incorrect amino acids are incorporated into the growing polypeptide chain, producing nonfunctional proteins. In addition, streptomycin causes the ribosome to randomly fall off the mRNA, preventing the synthesis of complete proteins. Puromycin is not used clinically but has played an important role in studying the mechanism of protein synthesis in the research laboratory. The puromycin molecule is the same size and shape as a tRNA/amino acid complex. When puromycin enters the ribosome, it can be incorporated into a growing polypeptide chain, stopping further synthesis because no peptide bond can be formed between puromycin and an amino acid, causing the shortened polypeptide to fall off the ribosome. Chloramphenicol was one of the first broadspectrum antibiotics introduced. Eukaryotic cells are resistant to its actions, and it was widely used to treat bacterial infections. However, its use is limited to external applications and serious infections. Chloramphenicol destroys cells in the bone marrow, the source of all blood cells. In bacteria, this antibiotic binds to the large ribosomal subunit and inhibits the formation of peptide bonds. Another antibiotic, erythromycin, also binds to the large ribosomal subunit and inhibits the movement of ribosomes along the mRNA. Almost every step of protein synthesis can be inhibited by one antibiotic or another. Work on designing new synthetic antibiotics to fight infections is based on our knowledge of how the nucleotide sequence of mRNA is converted into the amino acid sequence of a protein. Questions Why are antibiotics ineffective in treating the common cold and other virus infections?
Actinomycin D inhibits DNA-dependent RNA synthesis. Thisantibiotic is added to a bacterial culture where a specific proteinis being monitored. Compared to a control culture, whereno antibiotic is added, translation of the protein declines over a period of 20 minutes, until no further protein is made.Explain these results.
Resection of a bacterial chromosome in which genes for the enzymes of of a particular metabolic pathway are clusteredtogether in a functional complex under coordinate control is called operon activator promotor repressor operator
E The arrow in the diagram below indicates the direction of transcription. BTTL c. A ATGCCGCA AUGCCCCAAUCUG TACGGCGTTAGAC OA OB с Q Search Which letter indicates the 5' end of the DNA template strand? R F TTCACGCACTCATSTOFACCACGTA T G Direction of synthesis- CG STACATGAGIAC LOC Y H Krit & 7 FO U 99+ * 8 D ATEGTGCAT CVBNM MO DE 79 Alt F:-10 KL E 0 P ^ @ ¹ F12 Ctrl 10:37 AM 4/8/2023 10