Explain the steps of translation in as much detail as you can. What molecules are involved? What are the fundamental functions of the small vs. large subunits? What role do the following play: aminoacyl tRNA synthetases; A, P, E sites?

Explain the steps of translation in as much detail as you can. What molecules are involved? What are the fundamental functions of the small vs. large subunits? What role do the following play: aminoacyl tRNA synthetases; A, P, E sites?

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 5TYK: Which of the following statements is false? a. GTP is an energy source during various stages of...

See similar textbooks

Related questions

Q: THEME 2: Observe the figure below depicting cells undergoing meiosis and indicating which ones have…

A: Meiosis is a sort of cell division that takes place in sexually reproducing organisms and produces…

Q: In E. coli, the genes for histidine (his), arginine (arg), tyrosine (tyr), and valine (val)…

A: In this scenario, we are looking at the cotransduction of the histidine (his) and valine (val) genes…

Q: A pharmaceutical company just developed a drug (Cytarabine) that inhibits the activity of cytosine…

A: Cytosine deaminase is an essential enzyme for the metabolism of nucleic acids, including the…

Q: Suppose you came across a novel organism you suspected belonged to one of the following animal…

A: In biological taxonomy, a phylum is a taxonomic rank or category that denotes a significant…

Q: In a population of pika, you find that individuals vary in their fur color - there are greyish and…

A: According to the Hardy-Weinberg equilibrium concept the allele and genotype frequencies of a…

Q: 10x objective 100x TM Estimate the size of cells Using the 40X objective which is 400x TM. 40x…

A: Microscopy is the field of science that deals with the use of microscopes for viewing microscopic…

Q: What's the difference between moderately repetitive & highly repetitive sequences of eukaryotic…

A: Repetitive sequences are the DNA nucleotides that are repeated again and again. These sequences are…

Q: If we know that the hourly rate of IV fluid a child needs is 100ml/kg for the first 10kg of body…

A: IV fluid is short for intravenous fluid. It refers to fluid given intravenously to the patient. Such…

Q: Draw and label a picture of what a cell looks like during prophase.

A: The earliest phase of cell division, specifically in eukaryotic cells going through mitosis or…

Q: 1. What are the 4 phases of sexual arousal as described by Masters and Johnson? a. b. C.

A: Masters and Johnson, pioneering sex researchers, described a four-phase model of sexual arousal in…

Q: For simplicity, the monthly data has been summed into yearly totals. Survival: 60 were alive at the…

A: The question is about determining key parameters of a population based on survival and fecundity…

Q: What traits support classifying them as the same species? (Use complete sentences. Minimum of 2…

A: In the context of paleoanthropology, the classification of hominin fossils as members of the same…

Q: In 1-2 sentence(s) describe the major difference between ionotropic and metabotropic…

A: Ionotropic receptors represent a specific class of transmembrane ion channels. These receptors…

Q: Lumbosacral Coccyge nerve Posterior view What does "A" represent? spinal nerves conus medullaris…

A: The spinal cord is a lengthy band of tissue that resembles a tube. It ties your brain and lower back…

Q: OPTIONS GIVEN: 1. When the hammer/mallet strikes the patellar tendon, the muscle fibres stretch and…

A: The statement describes the reflex arc, specifically the patellar reflex (or knee-jerk reflex). It's…

Q: erection parasympathetic system?

A: The nervous system is a sophisticated system that serves as the body's command centre. It manages…

Q: Write explanatory notes on the morphology, importance to man and treatment of infection of the…

A: Coxiella burnetii: A distinctive Gram-negative bacteria with small, pleomorphic coccobacilli in…

Q: ss (-) RNA viral genome RNA polymerase RNA-dependent Coples (-) RNA strand RNA-dependent RNA…

A: Viruses are obligate intracellular parasites, meaning they can only replicate inside a living host…

Q: Which of the following is not a mechanism of action (how a drug works) for antibiotics? interfering…

A: Antimicrobials are agents that kill microorganisms or inhibit their growth. Antimicrobials typically…

Q: How many DNA fragments will result when the double-stranded DNA molecule below is digested with…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Model 3 – Random Genetic Drift This model is an adaptation of the classic experiment conducted by…

A: A key idea in population genetics is random genetic drift. It describes the erratic shifts in allele…

Q: what is the proper position for using an incentive spirometer?

A: Lungs are the important organs of the respiratory system allowing filtration of air that is inhaled…

Q: Three linked loci A, B, C (each with two alleles as in Question 2) in a random mating population…

A: Linkage disequilibrium refers to the non-random association of alleles at different loci, and it…

Q: At what age does an infant typically start to produce vocalizations? 4 months birth 2…

A: In the early stages of life, human infants go through a fascinating process of development,…

Q: Using the table, give the different types of feathers, their location in the body of the bird, and…

A: Feathers are a characterizing feature of avian anatomy, serving a large number of pivotal parts…

Q: Each Escherichia coli cell weighs 5ng. How many cells are present in a colony that weighs 1mg?

A: E. coli is a rod-shaped, Gram-negative, facultative anaerobic coliform bacteria of the genus…

Q: Based on the test scenario provided, choose what types of cranial nerves were involved and what type…

A: Cranial nerves are a set of 12 paired nerves (labeled "CN I-XII") that originate from the brainstem.…

Q: Reproduction is when new organisms are produced by parents and the parents pass: •genetic…

A: Reproduction is one of the characteristics of living organisms by which new individuals are born…

Q: What are the factos that affect callus formation, especially if it does not require sunlight (root…

A: Callus formation refers to the process in which undifferentiated, often unorganized plant cells…

Q: When you get a paper cut that bleeds, how deep into the skin is the cut? 11 10 9 12 8 7 1 2 Select…

A: Paper cuts are a common minor injury that occurs when the skin is slashed by a sharp edge, such as a…

Q: What will happen to the rate of FPP synthesis when FPP concentration is very high Inhibition of an…

A: FPP is farensyl pyrophosphate, one of the intermediates in cholesterol biosynthesis. It is a huge…

Q: 1. Experiences, positive or negative, do not leave a chemical signature on our genes. A True B False

A: Each cell in our body consists of a nucleus which has chromosomes inside. These chromosomes contain…

Q: The correct order of compaction from least compacted to most compacted would beThe correct order of…

A: In the case of eukaryotic cells the DNA remains associated with other DNA binding proteins and this…

Q: Which of the following statements is true regarding the typical American diet? We eat too much…

A: The normal American diet contains little fruit, vegetable, and whole grain consumption and is rich…

Q: Wild type fruit flies have grey bodies and straight wings. Yellow bodies and curly wings are both…

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…

Q: C11. A type A woman is the daughter of a type O father and a type A mother. If she has children with…

A: The determination of an individual's blood type revolves around the presence or absence of specific…

Q: Consider the pedigree below for the hairy toes trait, denoted with the gene symbols H and h (if…

A: A pedigree is a representation of the inheritance of a trait or character or disease from one…

Q: How could we promote rapid or slow signaling for medical purposes? So there are many examples of…

A: Most of the processes that occur inside the cells are due to a kind of response created by a…

Q: Briefly discuss what is relevant about biocultural evolution in terms of the fossil and prehistoric…

A: Biocultural evolution is a concept that recognizes the intertwined relationship between biological…

Q: You wished to develop a genetically engineered E. Coli to produce a peptide hormone. You know the…

A: Gene expression process involves transcription of a certain portion of a gene or DNA that results in…

Q: What traits support classifying H. habilis and H. rudolfensis as separate species? (Use complete…

A: The classification of early hominin species is a complex and dynamic field in paleoanthropology,…

Q: What is one important advantage of using environmental DNA (eDNA), instead of traditional…

A: e DNA or environmental DNA is the presence of DNA of an organism in a particular region. Each and…

Q: a) Dilution factor b) Dilution c) Both dilution factor and dilution d) Neither dilution nor dilution…

A: Solution is formed by the solute and the solvent. If the concentration of solute is more than the…

Q: Part 1: Fill in the Blanks Estimate the cell length in mm and um under the 40x and 100x objective.…

A: A microscope is an instrument that magnifies structures in such a way that one can see the…

Q: A friend was recently diagnosed with strep throat. One week after their treatment, his symptoms…

A: Strep throat is a bacterial infection caused by a bacterium species known as Streptococcus pyogenes.…

Q: Uncle 1 Cousin 1 A = normal allele Grandma 1 Aunt 1 Grandpa 1 Mom Sister 1 a = albino allele…

A: Pedigree analysis is a genetic analysis technique that involves the study of a family's genetic…

Q: transferred to *"*N-containing "light" medium for one cell division. The results of this experiment…

A: The Meselson-Stahl experiment, conducted in 1958, was a groundbreaking study that provided key…

Q: Studying the gene further in vitro showed that the U2 snRNP did not bind to the mutated RNA from…

A: One of the most important steps in the process of eliminating introns (non-coding sections) from…

Q: Why is Iodine used in the Gram Staining procedure?

A: Gram stain or Gram staining, likewise called Gram's strategy, is a technique for staining used to…

Q: Mitochondrial outer membrane permeabilization (MOMP) includes: Question 10 options:…

A: Mitochondria are highly specialized membrane-bound cell organelles found in the cells of eukaryotic…

Concept explainers

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.

Question

H2.

4. Explain the steps of translation in as much detail as you can. What molecules are involved?
What are the fundamental functions of the small vs. large subunits? What role do the
following play: aminoacyl tRNA synthetases; A, P, E sites?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1: Introduction and steps of translation

VIEW

Step 2: Molecules involved in translation

VIEW

Solution

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG AUGCCCACG UAG a) Identify the following elements on the diagram. Aminoacyl site (A) Peptidyl site (P) Exit site (E) Amino end of the newly synthesized polypeptide chain Carboxyl end of the newly synthesized polypeptide chain Approximate location of the next peptide bond that will be formed
1. By use of a labeled diagram or a written description, distinguish the roles of thefollowing in elongation of a polypeptide: initiation complex, charged tRNAs, peptidyltransferase, Site A, Site P 2. What determines the initiation of translation? (Hint: there is more than one feature oftranslation.)
1. Describe at least four ways in which transcription is different from DNA replication. 2. Describe and differentiate among the primary, secondary, tertiary and quaternary structures of a protein. 3. What is the role of these two important enzymes during translation: aminoacyl-tRNA synthetase and peptidyl transferase? 4. Describe four specific characteristics of the genetic code?
20. TRNA stands for transfer RNA, since a tRNA molecule transfers an amino acid to the growing protein molecule. You could also think of tRNA as translation RNA. Explain how tRNA molecules help the ribosome to translate the sequence.of nucleotides in mRNA to i sequence of amino acids in a protein. To see the process of translation in action, watch "Translation" at https://www.biointeractive.org/classroom-resources/translation-basic-detail. 21a. Fill in the blanks to label each type of molecule in this figure. a.tRNA $ & 7 8 9.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. A portion of the template strand of a DNA molecule that codes for the 5'-end of an mRNA has the following nucleotide sequence. Give the primary structure of the polypeptide (use 3-letter amino acid codes), beginning with the most common translation initiation codon, that will be specified by this portion of the gene. Be sure to label the ends of the polypeptide. 3'-TTTTACGGGAATTAGAGTCGCAGGATG-5'
1.) Define transcription and translation. How does transcription and translation differ in prokaryotes vs. eukaryotes (i.e. What is present in one but not the other)? 2.) What it means when we say that genetic code is redundant? 3.) Describe the stages of transcription (in detail for each step) - what components are required? 4.) Describe the stages of translation in eukaryotes (initiation, elongation, termination)
7. The large subunit of the ribosome contains the E, P, and A sites. Discuss what occurs at each site in a single round of translation elongation.
1. how is the initiation codon, identified by the ribosomes during translation in:1. prokaryotes and 2. eukaryotes 2. aminoacly-tRNA synthetase joins amino acids to their cognate tRNAs. Breifely describe the 2 reactions of aminoacylation.
1. Translation a)Explain the role of ribosomes in the process of protein translation.b. Explain the role of tRNA molecules in protein translation.c. Define the following terms:1. codon 2. anticodon. Explain how a codon is used in the process of translation.
3. (i) Referring to the genetic code (the codon usage table), what would be the amino acidsequence of the polypeptide encoded by the following mRNA sequence?5’ AUGGUGGCCUAUCAUUAGGGGCUU 3’(ii) What would be the effect on translation of the above sequence of a single base (point)mutation which gave rise to an A instead of a U at the twelfth base?(iii) What would be the effect on translation of the sequence in (i) above, if an extra Cwere inserted between the third and fourth bases, i.e., between the two Gs at position 3and 4?
7. A molecule of mRNA from bacteria is shown below: 5'- GUUUCCGAGGAGGCGUAUACAUGUCAGUGGGGGC... -3' a. The ribosome binding site (RBS) is underlined. i. What molecule specifically binds to the ribosome binding site? ii. Briefly explain why this binding is necessary for initiation of translation. b. During translation, which amino acid will be attached to the first tRNA that binds in the A site of the ribosome? c. Immediately following peptide bond formation, where will the amino acid chain be located? ( ) A site of the ribosome () P site of the ribosome i() E site of the ribosome F DAS8 b U G บบบ1 UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA U GUU GUC GUA GUG PHE LEU LEU ILE AUG}MET or START VAL UCU UCC UCA UCGJ C CCU CCC CCA CCG, ACU ACC ACA ACG GCU GCC GCA GCG Second base SER PRO THR ALA UAU UAC UAG} CAU CAC S CAA CAG A AAU AAC GAU TYR STOP HIS GLN ASN AAA AAG LYS ASP GAA GAG GLU UGU UGC CGU CGC CYS UGA STOP UGG} TRP G CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG G d. Describe the events…