Q: Are cells grown in the laboratory will function similarly when transplanted?
A: Transplanting laboratory-grown cells into the body causes them to behave similarly. For instance,…
Q: What phenotypes do you think a homozygous tra1hsn animal with a loss of function Egl-1 mutation…
A: The phenotype is the physical appearance or observable trait of an individual genotype. The…
Q: Mrs. and Mr. Bond have five children, Janine, Jaliyah, Joliette, Jelani and James Jr. Mr. Bond…
A: Given information Fragile X syndrome is an X-linked dominant disease. Mr. Bond has this disease…
Q: if you replaced the hox genes that are normally expressed in a dolphin fin with the hox genes that…
A: Gene expression is predominantly regulated at the transcriptional level, owing to protein binding to…
Q: Explain why this is not true about ion channel receptors; It forms hydrophobic hollow because it is…
A: Ion channel receptors are proteins that span the cell membrane and form a pore through which ions…
Q: Use the following information to answer the next question. A bacterium has been found that…
A: According to Bartleby guidelines a single question or in the case of question having subparts,…
Q: When will arm span and knee height be used? Are there any limitations on using these two methods?
A: When the accurate measurement for stature is unobtainable, other surrogates are used to predict…
Q: State how the distribution of bicoid protein changes after fertilization
A: this question from developmental biology. Bicoid protein is special type of protein which is found…
Q: Connective tissue comes in a variety of types. Explain how variations in this tissue type help to…
A: Connective tissue is widely distributed as well as one of most abundant tissue in our body. It is…
Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…
A: Cytotoxic T cells * MHC restricted * Antigen specific *Belong to adaptive immunity * Requires…
Q: 1. Why are some microorganisms capable of utilizing certain carbohydrates and some are not?
A: Depending on the unique enzymes of each bacterium, different energy sources are used by bacteria in…
Q: Human genes were integrated into the chromosomes of pig sperm using the procedure of sperm-mediated…
A: Q.1Ans:- B. DNA Replication. Explanation:- if we integrate the human sperm into the pig sperm…
Q: 2. Use the information provided in the table below to calculate the volume reduction and weight…
A: Given- There are four components given that is mixed paper, metals, plastics, organics etc. Values…
Q: 44. Experiments have shown increasing fertilization tends to reduce the numb resources for plant…
A: Any element in the environment that has the potential to restrict a process, such as the expansion,…
Q: Expression of yeast GAL genes are regulated by Mig1. A Mig1 mutant was identified that could not be…
A: Gal gene expression is subjected to exposure of galactose as well as combination of certain…
Q: In order to metabolize ethanol, the liver uses a pathway that involves alcohol dehydrogenase and…
A: Alcohol metabolism results in increased NADH, which decreases the activity of pyruvate dehydrogenase…
Q: Why sex? The comparison of parthenogenic species with sexually reproducing species demonstrates a…
A: The "life history" of an individual organism comprises important events linked to its growth,…
Q: 5. A patient receives a donor kidney to replace diseased kidney tissue. Consider and answer the…
A: Introduction: The crossmatch test is a crucial component of the living donor evaluation and is…
Q: 2. Sahelanthropus tchadensis Similarities and differences with other hominins
A: Evolution is a continuous transition of living forms, beginning with the basic forms of the past and…
Q: How has the significance of science knowledge changed over the centuries from the point of view of…
A: Scientific knowledge is crucial to our understanding of the world around us and how it works. It…
Q: can SDS-PAGE be used to determine the mass of a multimeric protein?
A: SDS-PAGE (sodium dodecyl sulphate-polyacrylamide gel electrophoresis) is a widely used technique in…
Q: 1 agagtctcct cagacgccga gatgctggtc atggcgcccc gaaccgtcct cctgctgctc 61 tcggcggccc tggccctgac…
A: Annotating a genome involves finding functional components throughout its sequence in order to give…
Q: Opportunistic infections are often the proximal (most direct) cause of death in individuals with…
A: Opportunistic infections (OIs) are infections that affect persons with impaired immune systems more…
Q: Suppose that a consensus sequence in the regulatory promotor of a eukaryotic gene that encodes an…
A: Gene transcription i.e., mRNA formation from the DNA required many transcription factors and RNA…
Q: Describe Scientific Method
A: A research proposal is a document that specifies the aims of the research and the techniques that…
Q: four main types of tissues on of
A: Tissue: It is defined as the group of cells which are having similar shape and specific function.…
Q: The sheep liver fluke is an organism that lives in the intestines, liver, brain, and lungs of sheep…
A: In case of multiple questions, first question is solved as per our company policy. If you want help…
Q: When you cross a female carrier for Color Blindness XCXc with a Color Blind male XcY, what is the…
A: An imbalance in how one or more light-sensitive cells (known as cones) located in the retina of the…
Q: Which of the following base sequences would be impossible to find on a DNA strand? A-T-A-T G-G-G-C…
A: The DNA consists of Adenine, Guanine, Thymine and Cytosine as nitrogenous bases.
Q: he following information to answer the next question cell cycle, cells in growing tissue normally…
A: A cell cycle is a series of events that occurs in a particular sequence in a cell as it grows and…
Q: Please explain whether CAR T-cells alter tumor cells expressing gasdermin -B, -E and -D when anti-…
A: Gasdermin is protein in humans, implicated in human response. It comprises six types in human, that…
Q: transcribe and translate the following using the codon chart: DNA TAC CCC AAG CTC GGT ATC
A: During transcription, C is replaced with G, G with C, T with A and A with U. Also, tRNA contain…
Q: secondary messengers can inhibit signals of other pathways. True False
A: Introduction Seconds messenger:secondary messenger are small molecules and ions that play a major…
Q: Which species are examples of intrasexual selection? Please select all correct answers. a. Elk b.…
A: Intrasexual selection is a selection in which there is competition occurs between members of the…
Q: The response. B cells, humoral O T cells, humoral produce antibodies as part of the O macrophages,…
A: Introduction: Immune system component known as an antibody that circulates in the blood and lymph in…
Q: WHEN do you think apoptosis occurs in humans? What would be the effect if apoptosis doesn't happen?
A: Apoptosis, or "programmed cell death," is an embryonic development mechanism that happens naturally…
Q: Concerning interface drug reactions, which statement is false? a. Most are caused by type II…
A: Dyskeratosis: Clinically characterized by the trio of aberrant nails, reticular skin pigmentation,…
Q: week when I mutated the SSA1 gene in yeast it made cells grow faster, but made them sensitive to…
A: Hypertrophy is the increase in cell size. Single gene exerting its effect on more than one trait is…
Q: Where on a neuron are you NOT likely going to find voltage-activated potassium, sodium, or calcium…
A: Our body has nerves that connect your brain to the rest of your organs and muscles. Our brain tells…
Q: Please answer fast Which of the following defines DNA barcoding? (more than one answer may be…
A: DNA barcoding has been widely hailed as a groundbreaking taxonomic discovery technique. It may be…
Q: Active immunization, as compared to passive, _______. A) only provides short term protection B)…
A: The development of immunity following exposure to an antigen (injected or given orally) is known as…
Q: Summarize the following in concise and understandable language.
A: SARS-CoV-2 It is Severe acute respiratory syndrome coronavirus 2 which is a strain of coronavirus…
Q: ACTIVITY 2: Protein Synthesis DNA: 3' A G C C GTA GA ATT is Using this strand of DNA as a template,…
A: The basis of inheritance is the information passed down from parent to offspring. The replication of…
Q: BugRx is a new biotechnology company in Cambridge, Massachusetts, developing human monoclonal…
A: Antibodies produced by B cells of white blood cells engage specifically chemically with antigens…
Q: Cells contain both DNA and RNA. What difference between the structures of these nucleic acids (that…
A: The DNA and RNA are nucleic acids found in the cells. DNA is present in the nucleus while RNA can be…
Q: Give a brief explanation of natural selection that includes all the necessary components for it to…
A: Natural selection is the process through which a population of living things adapts and evolves.…
Q: Explain the rationales behind ecological and social models of the evolution of primate cognitive…
A: Primates are distinguished from other mammals by unspecialized structure, specialized behaviour,…
Q: DNA is alway DNA mRNA 5' aal 3 51 PROMOTER AACGCATACGGGATAGCGCCCTGGTTCAAATGGCGGGCCGGCATCCC…
A: One of the core concepts of molecular biology is the flow of information from DNA to RNA to…
Q: Which of the following hypothetical islands would likely have the greatest species richness?
A: Biodiversity, often known as biological diversity, refers to the variety of life that can be found…
Q: 3'-TAC TGA GCA AGA TTA CAT ACT-5' Write down the mRNA sequence for the given DNA sense strand…
A: A mutation in both copies of the HBB gene results in sickle cell disease (SCD), a hereditary…
Explain how genes expressing a posterior marker might move to the posterior end of a gastroid.
Step by step
Solved in 2 steps
- a. Explain how you could use worms transformedwith myo-2::GFP to find mutations that disrupt thestructure of the pharynx. How would the presenceof the transgene facilitate the mutant screen?b. Nematodes homozygous for loss-of-function mutations in a gene called pha-4 have no detectablepharyngeal structures. How could you use myo2::GFP to determine if pha-4 is a master regulatory gene that directs development of the pharynxin a manner similar to the way Pax-6/eyeless controls eye development?Provide a short answer for each of the questions below. For individuals homozygous for the Duffy gene mutation, which increases resistance to malaria, answer the following questions: 1)What impact do you expect the GATA → GACA mutation will have on the level of Duffy protein expression in red blood cells? 2)What impact do you expect the GATA → GACA mutation will have on the level of Duffy protein expression in endothelial and Purkinje (brain) cells? 3)Explain how this mutation leads to the level of Duffy expression you expect in the different cell types.Children with EB might need feeding tubes. What is a gastric feeding tube? How does it work (provide a picture). . What are some of the treatments used to help with EB? Explain what Gene Therapy is and how it works (include diagrams). What cells would be targeted for EB?
- Given below is the electrophoretic profile of 2 proteins, a normal hemoglobin, HbA and the fetal hemoglobin, HbF. What information can be obtained from the profile shown? wwwwwww (+) HbF ww w (-) HbA ww ww A. HbF has a slightly different conformation compared with HbA B. HbF and HbA have different primary structures C. HbF has a higher affinity for oxygen than HbA D. HbF has a nonpolar amino acid residue in place of a basic amino acid. E. HbF has an acidic amino acid residue in place of a nonpolar amino acidhow does carbohydate and protein assay affect the presence of various digestive enzymes in each sections or regions of the digestive tract of animals?From a genetics point of view in simplified terms Breakdown Muscular Dystrophy 1.) Explain the specific genes involved 2.) Explain becker vs. duchenne dystrophies 3.) Explain treatments
- compare and explain which genes from these from the CIN,MSI,CIMP pathways have the strongest links to colorectul cancer and which genes have the weakest. Give full explaions with thr Gene examples.How are the molecular interactions between Hoxd13 and Hoxd11 and Shh and Gli3 in the limb similar?please help me I can't find answers for these questions: here is the link for the article https://www.pbs.org/wgbh/nova/transcripts/2805cancer.html What type of substances are angiostatin and endostatin and where are they produced? What do they do? A) describe the experiments using cow bones to discover anti-angiogenic substances. Why was this used as a source of these potential proteins? B) describe the “accidental” discovery of a novel antiangiogenic substance because of lab contamination?