Estimate the pl (isoelectric point) of a protein with the amino acid composition below. . Arg: 3 Asp: 1 Glu: 5 His: 2 Lys: 1 . . . .

Q: Explain the functions, food sources of Folacin (folicacid)

A: Folate or folic acid also known as vitamin B9. It  is a water-soluble vitamin that plays many…

Q: Does an athlete need additional vitamins for optimal performance? Explain.

A: Vitamins and minerals are essential for body functioning. The deficiency of vitamins and minerals…

Q: What is the recommended adequate intake for dietary fiber.

A: Dietary fiber, or simply fiber, is an essential ingredient in plant-based diets that the human body…

Q: What are the pathways of distribution and transport for the contaminant of arsenic? AND What…

A: One of the inorganic pollutants regulated by the Phase II/V Rules is arsenic. The Arsenic Rule,…

Q: Define anoxygenic

A: Anoxygenic is described as a process in which oxygen is not involved as a reactant and is not…

Q: How is calcium recycled?

A: Calcium can be defined as the mineral that is important for life. Furthermore the fabrication…

Q: c. List the ketone bodies?

A: Introduction :- Ketone bodies are water-soluble molecules containing ketone groups generated by the…

Q: Oxidation of ingested CHO during exercise depends on each of the following variables except... Group…

A: Carbohydrates are one of the essential nutrients present in the food. It is made up of carbon,…

Q: When would you not use ice?

A: Cold application or cryotherapy. Cold causes constriction of blood vessels and leads to  Reduced…

Q: Discuss the formation of free radicals and their impact on cell and tissue health.

A: Introduction :- Any molecular species that is capable of independent existence and has an unpaired…

Q: The signs of deficiency of Vitamin D

A: For normal health and growth, certain organic substances such as vitamins are necessary in small…

Q: Define the role of oligodendrocyte ?

A: Oligodendrocyte, a type of neuroglia found in the central nervous system of invertebrates and…

Q: Identify the types and dietary sources of triglycerides, and describe their functions.

A: Triglycerides are fats from the food we eat that are carried in the blood. Most of the fats we eat,…

Q: What is the official name of pyruvic acid?

A: pyruvic acid is an alpha-keto acid wherein the C atom of the carboxylic acid group [-COOH] forms the…

Q: What will be the predominant form(s) of the amino acid at pH (i) 1.5; (ii) 3.0; (iii) 4.5; (iv) 6.0;…

A: Amino acids contain many ionizable groups which can present in protonated and deprotonated states.…

Q: Describe the importance of calcium in the body.

A: Calcium is one of the important minerals in the body. Calcium is required by the body to maintain…

Q: State the function of triglycerides in the human body.

A: Macromolecules are large molecules or polymers which are formed from the simple monomers which are…

Q: How is BMR measured?

A: Nutrition is a critical part of physical development and mental development. A balanced diet is…

Q: Describe how a cholesterol stone forms.

A: The gallstone blockage may cause episodes of discomfort in the upper right abdominal quadrant. This…

Q: Given that lactate accumulation will adversely affect endurance, what test might be an indicator of…

A: Maximal oxygen consumption refers to the maximum oxygen that can be utilized by an individual during…

Q: Define the term TENS?

A: The term TENS is related to the nervous system. A nervous system is a collection of neurons and…

Q: 9

A: We know that Nutrition is defined as the biochemical and physiological process where the organism…

Q: Explain the functions of calcium in the body.

A: Calcium is an alkaline earth metal with atomic number 20. Calcium is majorly obtained through dairy…

Q: 10.12 2. What is the clinical significance of ALT?

A: Alanine aminotransferase, or ALT, is an enzyme that is mostly found in the liver. ALT's purpose is…

Q: Clinical significance of lipid testing.

A: A lipid test is done to detect the abnormalities in the lipid. where the lipid test was used to…

Q: List important sources of acids in the body.

A: The body maintains the buffering capacity by maintaining the concentration of different ions in the…

Q: Differentiate between abrupt onset hypoglycemia and gradual onset hypoglycemia.

A: Hypoglycemia is a medical condition characterized by abnormally low levels of blood glucose,…

Q: 39 40 41

A: 39 answer is... Half serving of brown rice, 1 slice of pork cutlet, 3 strips of fish fillet, egg,…

Q: Identify the mechanism of folic acid and describe. Types include oral, parental( intravenous, intra…

A: Folic Acid are generally used to prevent anemias ie Folic acid deficiency. It consititutes of…

Q: What is the use of BAC?

A: Artificial chromosomes are genetically engineered chromosomes that contain deoxyribonucleic acid…

Q: a. Construct a typical wax derived from palmitic acid. No sticks are acceptable. CH2 groups can be…

A: Waxes are esters of long-chain fatty acids and monohydroxy alcohols. They are highly insoluble. The…

Q: An individual is sailing off the coast of a remote area and is blown out to sea by a freak storm,…

A: All chemical processes required to maintain cells and an organism in a live state collectively are…

Q: Discuss how the body changes BP during exercise.

A: A natural blood pressure level is 120/80 mmHg. Age is not a matter . you  take steps each day to…

Q: (a) Why is the glucose strenght in the mussle lower than in the blood, and why is it not possible to…

A: Glucose is an important fuel for contracting muscle, and normal glucose metabolism is vital for…

Q: (a) 5' 3' GGCGCAGUGGGCUAGCGCCA (b) (((((..AAAAAA. ))))) (၁) AAAGGCCCAU aaaaaa.

A: The H-type pseudoknot is a common RNA structure composed of two helical stems (S1 and S2) and two…

Q: Define fats and oils. What property do they contribute to an ointment?

A: Biomolecules are organic molecules that function within the living system. Biomolecules are…

Q: Write and briefly explain liver functions.?

A: The liver is the largest gland of the body. It is placed in the right upper quadrant of the…