Erwin Chargaff discovered that although the nucleotide composition of DNA varies from one species to another, that composition always follows certain rules. While variation in nucleotides helps to explain the complexity of life, the physical structure of the DNA itself can also help certain organisms adapt to particular environments. Imagine you are working with a research team sampling the ocean floor near a hot vent that releases a steady stream of hot water. The hot water has a temperature of about 45°C, while the surrounding ocean has a temperature of 6°C. Nucleotide Presence in DNA of bacterial Presence in DNA of bacterial sample 1 (percent) sample 2 (percent) adenine 21 36 cytosine guanine thymine Your team collects two samples of bacteria - one from the mouth of the hot vent and one from the ocean floor about 20 m away. When you return to the lab, you isolate the DNA from these bacteria to determine their nucleotide composition. The table shows the results of your test for the adenine content of the DNA.

In an attempt to understand whether viruses rely on proteins or nucleic acids to transmit their genetic information into their host cells, scientists were able to track the movement of phosphorus and nitrogen from the virus to its host cell. Which of the following describes the most likely conclusion from this observation? A B с D The molecule that is transmitted by the virus is a protein since proteins contain nitrogen but nucleic acids do not. The molecule that is transmitted by the virus is a protein since proteins contain phos- phorus but nucleic acids do not. The molecule that is transmitted by the virus is a nucleic acid since nucleic acids contain phosphorus but proteins do not. The molecule that is transmitted by the virus is a nucleic acid since nucleic acids contain nitrogen but proteins do not.

A DNA sequence such as the one shown below has symmetry. 5' TGGAATTGTGAGCGGATAACAATT 3 3' ACCTTAACACTCGCCTATTGTTAA 5

Why do you think all organisms use nucleic acids for encoding genetic information? Why not use proteins or carbohydrates? What advantages might DNA have as the source of genetic information?

Which of the following describes the DNA molecule? A DNA molecule is single-stranded and is composed of phosphate and two nitrogenous bases (thymine and cytosine) that follow complementary base pairing rules T-C. A DNA molecule is double-stranded and is composed of sugar, phosphate, and four nitrogenous bases (adenine, thymine, cytosine, guanine) that follow complementary base pairing rules A-T and C-G. A DNA molecule is single-stranded and is composed of sugar and four nitrogenous bases (adenine, thymine, cytosine, guanine) that follow complementary base pairing rules A-G and C-T. A DNA molecule is double-stranded and is composed of sugar and two nitrogenous bases (adenine, and guanine) that follow complementary base pairing rules A-G.

A double-stranded molecule of DNA has 80 T nucleotides and 110 G nucleotides. What is the TOTAL number of nucleotides in this molecule of DNA? O 80 O 110 O 160 O 190 220 O 380

DNA carries digital information in the sequence of its how manybases.?

Boring magasanik collected data on the proportion of each base in RNA  from different species. To compare the relative amount of each base, he standardized thr value of adenine to 10. Relative amounts of other bases were calculated based on this value for adenine. For each of the listed body parts listed, give the proportion of purine to pyrimidines in a decimal form. Rat liver nuclei Rabbit liver nuclei Cat brain

consider dna nucleotide sequence CCATGGAATCGA What structure of dna does the sequence represent?

While doing research on deep-sea vents, you discover a very simple new life form. After some initial analysis, you find that this life form contains small fragments of DNA, small complementary RNA fragments, and proteins. You wish to discover which of those three molecules could be the genetic material. The classic experiment of which of the following scientists would be the MOST appropriate to mimic? O Avery, MacLeod, McCarty O Hershey, Chase O Fraenkel-Conrat, Singer O Griffith O Franklin