Enumerate 5 ways in which our body repair the mismatches in the DNA replication. Stare the different repair mechanism.

What is the function of DNA polymerase in DNA replication? to create replication bubbles by unravelling the parental strands of DNA to insert new bases during elongation, using the parent strand as a template to create an RNA primer to initiate DNA replication to anneal (splice) smaller fragments of DNA to create one continuous strand O all of the above

Which enzyme starts at an RNA primer and elongates the new DNA strand?     DNA primase     DNA polymerase III     RNA polymerase     DNA ligase     DNA polymerase I

1. What are chromosomes and where are they located? 2. How many chromosome do humans have? How are chromosomes inherited? 3. What are the components of a nucleotide? Name the four types of nucleotides. 4. What type of bonds holds the two DNA strands together? 5. What is complementary base pairing? 6. How does the DNA between individuals differ? 7. Define DNA replication 8. What is the function of the enzyme helicase in DNA replication? (unwinds and unzips DNA) 9. What is the function of the enzyme DNA polymerase in DNA replication? 10. DNA replication is semiconservative. Explain what this means. 11. Which method do scientist utilize to make extra copies (amplification) of DNA? 12. Describe the PCR technique. Why do scientist add primers, DNA polymerase and nucleotides during PCR method? Explain the purpose of each.

What will be the outcome for any resulting protein from this this DNA segment  

Click Submit to complete this assessment. Question 20 Why do most replication errors occur? O 1. DNA polymerases work very fast and mistakes are inevitable. O 2. DNA repair mechanisms do not work well O 3. DNA replication is a slow and uncommon process. O 4. The hydrogen bonds between base pairs are weak. 5. DNA ligase often binds incorrect sections of DNA. A Click Submit to complete this assessment.

Exit Ticket: Use the diagram below to answer the following questions. DNA Samples 1 2 3 4 5 6 7 Question # Question Answer and Justify 1 This technique used to analyze DNA directly results in (1) synthesizing large fragments of DNA (2) separating DNA fragments on the basis of size (3) producing genetically engineered DNA molecules (4) removing the larger DNA fragments from the samples This laboratory technique is known as (1) gel electrophoresis (2) DNA replication (3) protein synthesis (4) genetie recombination 3 Name one other way besides crime scenes that Gel Electrophoresis can be helpful technology! III| | || || || I||| 2.

Please help me describe in detail the process of DNA replication. Can you please include all enzymes involved and the leading and lagging strands. Also is there any way to make it more understanding than the text books im having trouble understanding it.

DNA strand  1 (template) TACATGCTCGTGACTTTT  Mutation in strand 1 TACATGTCGTGACTTTT DNA Strand 5 (template) TACAGGTGTTCCCAGATCGGG Mutation in DNA strand 5 TACAGGTGTTCCCATATCGGG 1.use the original (template) strand of DNA to find the correct amino acid sequence in the DNA. 2.find and highlight the mutation in the DNA. 3.Find the new sequence of the amino acids for the protein in the new mutated strand of DNA. 4.Determine if this mutation is a point mutation of a Frame shift Mutation. 5.Determine if it is a silent mutations, Missense mutation, Nonsense mutation, Insertion or Deletion. 6.will this new protein function the same as the old protein? Why or why not?