Elaborate on Common Reproductive System Diseases: (Pathogen, Symptoms, Diagnosis, and Treatment) Note: Follow the table below. Candidiasis Bacterial Vaginosis Trichomoniasis

Q: What are the additional parts of a bacterium needed for infection of host? Answer this completely…

A: One of the most diverse groups of living things is bacteria, which have evolved to a wide range of…

Q: LO73 Determine which nucleotides are methylated based on a sequence that has been treated with…

A: Introduction :  Bisulfite sequencing is the process of treating DNA with bisulfite before performing…

Q: 5- crossover misalignment. B-Causes a duplication of a certain portion of chromosome while the other…

A: Introduction:- Evolution is defined as the descent with modifications. Evolution of life forms is…

Q: Skeletal productivity can be quantified by dividing the maximum diameter of the ____ by the diameter…

A: Skeletal robusticity indicates the strength of a skeletal section in relation to some mechanically…

Q: 1. True or False: 1. WBC's, like monocytes can live for years 2. Changes in elevation affects…

A: 1. First of all, monocyte itself is a WBC. Also life span of WBC's is around 13 to 20 days and not…

Q: What is Scientific revolution? Why do we students have to learn about this?

A: Answer : Early modern science was reproduced during the scientific revolution, when discoveries in…

Q: Following a fracture of cervical vertebra a patient exhibit spastic paralysis on the right upper and…

A: Given that the patient has a fracture of cervical vertebra, spastic paralysis on right side and loss…

Q: Pollen contains the complete genetic material of the plant and is airborne. Describe the ways in…

A: Pollen represent the highly reduced from of male plant's gametophyte. It is usually called as…

Q: Predation is an interaction between two species best described how? One species benefits from the…

A: Predation is the type of interaction in which an organism (predator) kills and eats the other…

Q: apolysis Known as instar The Stage from another is True o False one to

A: Question:- The stage from one apolysis to another is known as instar True False Right answer:-…

Q: generated from this gene. Be sure to appropriately label the ends of the molecule.…

A: Introductions Transcription is the  DNA based gene expression,  DNA segment will be copied…

Q: QUESTION 27 What is meant by simultaneous translation transcription and why can this happen in…

A: The process of converting a gene's DNA sequence into an RNA molecule is known as transcription, and…

Q: A temperature-sensitive mutant allele of Ras causes the Ras protein to be fixed in the GDP-bound…

A: Introduction The various kinds of genes that have an abnormal function at higher temperatures and…

Q: What is the function of the nose in terms of the respiration tract and air being drawn into the…

A: Ans: Nose is the fleshy protrusion in the middle of the face made up of skin and other soft tissues,…

Q: There two questions that will be asked interview for applying to be in the lab field. What are your…

A: My strengths are ---- Im completed my degree with a very good performance and i'm a skilled…

Q: Cancer develops from the accumulation of multiple mutations within a single cell. Name the 3 sources…

A: Errors in DNA replication during cell division, exposure to mutagens, or viral infection can all…

Q: transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' UCCUUAC 3' Which of the…

A: Coding strand is the that strand of DNA whose sequence is identical to the mRNA sequence while…

Q: How does RNA polymerase recognize the start and end of a gene?

A: The crucial enzyme that converts the genetic data encoded in DNA or deoxyribonucleic acid to RNA or…

Q: Which of the following is an objective for the following study: Male birds are usually more colorful…

A: Males are often more colourful than females in the animal world because of sexual selection. This…

Q: LO 61 Explain how Next gen sequencing works What is true about Next gen sequencing? Amplifies a…

A: Option 4 (It can sequence a whole genome in one huge strand) is also true.

Q: S A widow's peak hairline is dominant (W) to a straight hairline (w). Karen and her both have a…

A: Given that widow's peak is dominant (W) over straight hairline (w). Therefore, person with a…

Q: The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: Introduction  Gene expression is the process through which a gene's information is utilised in the…

Q: .is stachyose found in plant‘s seed or root？or leaf？ 2.Does stachyose present in human‘s milk？ 3.…

A: A tetrasaccharide called stachyose is made up of sucrose and an alpha-D-galactose moiety that is…

Q: A fish suddenly has to swim in order to escape a predator. This type of activity is and uses ATP…

A: Fish are aquatic animals that live in the sea, rivers, lakes, and oceans. Individuals increasingly…

Q: What method allows researchers to make a large amount of human proteins in bacteria? Select one: a.…

A: The correct answer is option d. Gene cloning. Gene cloning is one of the methods that allow…

Q: Why is variation advantageous to populations?  How does this relate to species that reproduce…

A: Reproduction is a phenomenon of fusion of two gametes and formation of zygote . It is a…

Q: Choose the answer that correctly fills in the blanks. As carbon dioxide accumulates in the…

A: More carbon dioxide is evaporating into the ocean as a result of human-driven increases in…

Q: In mitosis, why do the chromosomes need to condense in prophase and line up in metaphase?  (To be…

A: Mitosis is a process in which eukaryotic cells usually divides into two. Prokaryotes usually lacks…

Q: During the 20th Century, scientists in the USSR undertook a program to domesticate foxes. The…

A: Foxes who were most willing to interact with humans were considered the most tamed ones. They were…

Q: The two molecules of pyruvate (pyruvic acid) results in the following products 2 molecules of…

A: pyruvate is a end product of glycolysis cycle.   pyruvate oxidation in mitochondrial metrix produce…

Q: 6. Most of the water and solutes is absorbed in the large intestine 7. Antibodies are produced from…

A: Large intestine are responsible for majority of water and solute absorption, whereas small…

Q: G-LO37 Identify the consequences of mutations in different regions of a gene. The image below…

A: A mutation is a change to an organism's DNA sequence. Errors in DNA replication during cell…

Q: Which of the following is a correct way to distinguish reptiles from amphibians? a. Reptiles have…

A: Reptiles are vertebrates whic are cold blooded. They have dry skin that is covered with scales or…

Q: For this plant with binomial name Ixora coccinea L., What is the reference to the publication of…

A: Linnaeus named the genus Ixora in 1753; but, historically, it has frequently been merged with the…

Q: Why is it more likely that insertions or deletions will be more detrimental to a cell than point…

A: Frameshift mutations Point mutations It refers to the mutation that changes the reading frame of…

Q: The DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using…

A: DNA is a double helical structure with two DNA strands. One strand serves as a template for the…

Q: Once the nucleotide in the picture is added to the 3’end of growing strands, DNA synthesis is…

A: Introduction: DNA molecule end  has a number. One end is referred to as the 5' (five prime) and…

Q: Examine the structure shown below and answer the following questions: 1. Name the structure (be as…

A: Nucleic acids or nucleotides are usually consists of mainly nitrogen bases, sugar, and phosphate…

Q: Would the viral insertion of a proto-oncogene into a region of genomic DNA with non-acetylated…

A: Acetylation reduces the affinity between histones and DNA by removing positive charges. Thus,…

Q: a) Suppose the frequency of the recessive allele a for the recessive condition albinism is 0.2…

A: According to our guideline we can answer only first three subparts of a question. So, upload the…

Q: Choose 1 organism below and propose a method of fossilization that most appropriately matches the…

A: The fossil record is a highly organized series of fossils discovered in sedimentary rock strata.…

Q: A beaker contains two compartments (A and B) with equal volumes of solution separated by an…

A: Since beaker A contains 3% albumin solution and beaker B contains 2% potato starch solution.…

Q: What is the climate for modern society and how does climate change impact the environment, if at…

A: Environmental science is one of the sciences that we must learn that every living thing on this…

Q: A certain autosomal recessive trait occurs in a population with a frequency of 1 in 4900. Assuming…

A: According to Hardy-Weinberg Principle, there will be a constant genetic variation in a population…

Q: this did not answer d, e, and f of part (c)

A: The enzymes here given are those enzymes which mainly control the metabolism of glucose and…

Q: Squirrel’s probable causes for the endangerment, extirpation, etc Please include references you use…

A: Due to some human activity, species can enter into a new geographical area which is different form…

Q: The head of the oncology divison of a large biotech company proposes to develop a therapeutic…

A: For cancer treatment, there are several options. The treatment a patient receives depends on the…