Draw neat diagrams of chloroplast and mitochondria label the parts indicating the products (glucose and ATP) in the organelle.

Q: Where in mitochondria does electron transfer phosphorylation occur?   Inner membrane   Matrix…

A: Electron transport chain is a series of reaction in which transfer of electrons took place across…

Q: Draw a schematic diagram on the Oxidative phosphorylation and identify the input and output…

A: Oxidative phosphorylation is the metabolic pathway in which cells used engine to oxidize nutrient to…

Q: True/False: One organelle found in many photoautotrophs but not heterotrophs is the nucleus.

A: A cell is a structural and functional unit of life. The structure and function of a cell have been…

Q: write the biomechanics part of the mitochondria

A: Mitochondria is an energy-producing organelle of the cell and the energy is used up in many other…

Q: There is a toxic metal that can puncture the outer membrane of the mitochondria which creates a gap…

A: The outer membrane is the gateway to the mitochondrion, just like the cell membrane is for the cell.…

Q: This diagram is of a mitochondrion. Which label shows the site of the citric acid cycle? E Chris a)…

A: Cell is an elemental unit and part of structural organization of body which comprises of various…

Q: Where is ATP Synthase located in the mitochondria?     Intermembrane space     Matrix…

A: ATP synthase is an enzyme that catalyze the formation of energy in form of ATP in cellular…

Q: Compare and contrast the structure and function of the mitochondrion and the chloroplast

A: Ans- Chloroplast, and Mitochondria are organelles found in living organisms' cells that perform…

Q: ATP synthase produces ATP in the: Intermembrane space Mitochondrial matrix Outside the cell Cytosol

A: Cellular respiration is a metabolic phenomenon in which glucose is degraded to release energy.It…

Q: Explain how cell produce source of energy that supports life on Earth and how this energy is passed…

A: Energy is the basic requirement of every living cell. Energy is required to perform all the…

Q: Draw a picture of mitochondria. label the inner membrane, outer membrane, Inter membrane space and…

A: Mitochondria is the powerhouse of the cell. This organelle is involved in cellular respiration that…

Q: All of the chemical reactions within a cell occur in the Nucleus Golgi apparatus OCytoplasm…

A: All of the chemical reactions within cell occurs in the Cytoplasm. Enzymes are inside the cytoplasm…

Q: Schematize below the biochemical reactions (including their substrates and their end products),…

A: The organelle that is depicted in this picture is the mitochondria. Mitochondria is known as the…

Q: Please explain how eukaryotic cellular membranes are dynamic structures.

A: Introduction  Cell is the basic unit of life. All organisms be it single cellular or multicellular,…

Q: What does the presence of many mitochondria imply about a cell’s energy requirements?

A: The mitochondria are the powerhouse of the cell because it produces ATP. ATP is energy currency…

Q: From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to…

A: BLAST (Basic local alignment search tools) is online algorithm and program to compare the biological…

Q: Define Organelle Heredity: DNA in Chloroplasts andMitochondria ?

A: Mitochondria are organelles that are present in almost all cells, while chloroplast is an organelle…

Q: Mitochondria and chloroplast have their own DNA and replicate separately from the nucleus and they…

A: Genetic is the branch of science that deals with genetic material like genome, genes, DNA, and…

Q: describe Anatomy of a mitochondrion

A: Mitochondria is one of the most important organelles of a cell. It generates the energy currency or…

Q: Define the term cytosol?

A: Cell is a structural and functional unit of living organisms. Several cells joined together to form…

Q: The mitochondria are often referred to as "the powerhouse of the cell," which is true, but an…

A: Mitochondria is present in all eukaryotic cells. It is double membrane bound cell organelles. It is…

Q: This statement is incorrect about mitochondrial membrane

A: Mitochondria is the cell organelle that is known as energy currency generator of the cell

Q: Which taxon is most closely related to Mitochondria

A: In eukaryotic cells, the mitochondrion is an extremely fascinating and significant organelle. It is…

Q: The main components of a mitochondrion are: O Outer membrane O Thylakoid membrane O Cytosol O Inner…

A: Mitochondria The name “Mitochondria” comes from Greek word, “Mito” means tread and “chondrion” means…

Q: Compare the function and structure of mitochondria and chloroplast in detail

A: The cytoplasm of the cell is divided into compartments enclosed by a membrane to perform a…

Q: Eukaryotic cells contain complex structures enclosed within complex membranes called…

A: Both Eukaryotic and prokaryotic cell produce energy but in different manner prokaryotic cell produce…

Q: The organelle shown is used by plants to carry out photosynthesis. What is the name of the…

A: The living, self replicating, structural and functional unit of all living organisms is called cell.…

Q: Where does the process of cellular respiration occur?     mitochondria     endoplasmic reticulum…

A: The process of cellular respiration occur in mitochondria and anaerobic respiration take place…

Q: Contrast the functions of mitochondria and chloroplasts, and discuss ATP synthesis by each of these…

A: Mitochondria are double membrane bound organelles found in all the eukaryotic cells. The avarage…

Q: Do plant cells have mitochondria? Explain.

A: Photosynthesis is a process by which carbon dioxide and water are broken down to produce glucose…

Q: Most of cellular respiration occurs inside of which organelle?   Chloroplasts   Nucleus   Golgi Body…

A: Answer: Introduction: Cellular respiration is the method in which glucose molecule break down takes…

Q: A researcher analyzed a sample of cells and found that they contain cellulose, the primary molecule…

A: Cellulose is a polysaccharide made up of linear glucan chains bound together by β-1,4-glycosidic…

Q: Where does glycolysis take place?   cytosol   matrix   cristae   mitochondria

A: Glycolysis is process of breaking down of glucose molecule into pyruvate and hydrogen ion . In…

Q: Prokaryotic cells that can use cellular respiration to make energy perform some of that process…

A: Cellular respiration is the process in which organic material ( glucose ) is broken down and…

Q: Using diagrams and words, compare and contrast the three different ways that cells make ATP in the…

A: Glycolysis is an ancient, major ATP-producing pathway that occurs in almost all cells, eukaryotes…

Osmosis

In simple words, osmosis is the slow, gradual movement of a liquid through a membrane. But there are nuances to this process. For instance, there has to be an imbalance in the distribution of solute in the liquid on either side of the membrane, which has to be semipermeable. The liquid in the region with a lower solute concentration moves to the region with a higher concentration, thereby displacing the solution in the process. The objective is to equalize the concentration of molecules on both sides of the membrane; the displacement of liquid can be viewed as a byproduct of this equalization. Since there is no energy required to carry osmosis, it is considered a passive process.