Answered: Does cellular respiration occur in the…

Does cellular respiration occur in the cytoplasm or in the mitochondria? Explain and answer in digital format Make schematics and diagrams

Human Biology (MindTap Course List)

11th Edition

ISBN:9781305112100

Author:Cecie Starr, Beverly McMillan

Publisher:Cecie Starr, Beverly McMillan

Chapter3: Cells And How They Work

Section: Chapter Questions

Problem 10SQ: Cellular respiration is completed in the ______. a. nucleus b. mitochondrion c. plasma membrane d....

See similar textbooks

Related questions

Q: N mRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Alanine Arginine…

A: Disclaimer: “Since you have posted a question with multiple sub-parts, we will solve first three…

Q: A glycocalyx functions in all of the folowing ways EXCEPT: a) adherence to non-living surfaces, such…

A: A glycocalyx is a loose sheet present around the bacteria cells.

Q: of macrophages?

A: Macrophages are tissue-resident or infiltrated immune cells critical for innate immunity, normal…

Q: Which of the following components of the cell membrane is found exclusively in the inner layer of…

Q: Write TRUE if the statement is correct, FALSE if otherwise. JOOHOB OBTAROSTI 11. Food undergoes…

A: Since you have asked a question with multiple subparts, we will answer only first 3 subparts for…

Q: ITEM I MSM MICROBIAL PROFILE MICROORGANISM/CAUSATIVE AGENT GRAM REACTION A B OXYGEN REQUIREMENT C D…

A: Malaria is brought on by a type of protozoan called Plasmodium falciparum. Malaria is a serious…

Q: Greg and Susan have Nail- Patella syndrome (NPS). NPS is an autosomal dominant. Greg has a blood in…

A: Introduction The nails, knees, elbows, and pelvis are abnormal in people with nail-patella…

Q: Why/how is pyruvate oxidized after glycolysis and before it enters the citric acid cycle?

A: Pyruvate oxidation, one of the four phases of cellular respiration, stands out since it is one of…

Q: Please answer fast 3) There are very few native reptile and amphibian species in Maine. What…

A: Abiotic components are the non living components of ecosystem, which controls and determines the…

Q: Describe the cultural, social, political and economic activities of the following stages of human…

A: Evolution :

Q: Eukaryotic messenger RNA includes a poly A tail. When the poly(A) tail is less than approximately 30…

A: Introduction Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that, in molecular…

Q: Biology The food web of the harp seal is most dependent on which of the following organisms?. 1.…

A: Food-web is defined as "the network of complex interactions among species in an ecosystem"

Q: In which of the following foods are microorganisms involved in their production? Coffee Chocolate O…

A: Microorganisms contaminate food throughout the process, from harvesting to preparation to…

Q: Calculate the matching probability (pM) and the power of discrimination (PD) for a gene with two…

A: Each gene allele has a particular frequency of occurring in a population. Matching probability and…

Q: How do molecules of atp store and provide energy for the cells ?

A: Adenosine triphosphate (ATP) is the source of energy for use and storage at the cellular level. The…

Q: 17-19. A man and women of normal phenotype have a son with Duchenne muscular dystrophy, a sex-linked…

A: The correct option is (c) A=1/2 OR 50%,B=0%,C=1/4 OR 25%

Q: The genetic disorder sickle-cell anemia occurs when the amino acid valine takes the place of…

A: Sickle cell anemia is a type of blood related disorder which is also known known as sickle cell…

Q: Which of the following proteins preserves an epigenetic alteration of DNA? O MYOD O Ey O HAT…

A: Introduction Epigenetics is the study of how changes in your environment and behaviour can have an…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: Question 9 o Which of these is true about the pO2 at the end of the pulmonary capillaries in…

A: Pulmonary capillaries are the smallest blood vessels inside the lungs. It carries deoxygenated blood…

Q: what could have happened to the isolates when she re-streaked them repeatedly and recommend a…

A: Mangroves are part of the coastal ecosystems in the sub-tropical and tropical regions across the…

Q: Direction: Answer the following questions. 1. What distinguishes humans from other animals? Why? Can…

A: The humans who has a evolutionary past with their ancestors are highly civilized with several…

Q: What is the difference between A-delta and C fibers?

A: Nociceptors are made up of different kinds of nerve fibres (axons) that have free ends. The diameter…

Q: Find the number of traits expressed by each species. Find the number of species possessing each…

A: Disclaimer: According to Bartleby guidelines only the 1st question can be answered. Please repost…

Q: Discuss the mechanistic approaches and limitations for the detection of aerosolized respiratory…

A: When an infectious agent is transmitted via air with the help of droplet nuclei which are also known…

Q: What conditions compromise host defenses against microorganisms?

A: The term "human microbiome" refers to the complex biological system of microbes that resides in and…

Q: Which of the following is most expected with polycythemia? a) Decreased blood viscosity b) Decreased…

A: Blood cancer of this kind is called polycythemia vera. The bone marrow produces an excess of red…

Q: 2. To tube 1, add 10 μl of 50:50 AT:GC DNA (tube B). 3. Add 5 μl of Buffer to tubes 2-7. 4. Remove 5…

A: The results of a polymerase chain reaction (PCR) are significantly influenced by the overall amount…

Q: Which is the correct equation for the chisquare statistic? Group of answer choices a)x^2 =…

Q: The volume of ejaculate in a man during sex with a partner is related to a The time since last…

A: Introduction The ejaculation of males is called "semen". It contains numerous sperm and out of all…

Q: How are genes transmitted from parent to offspring?

A: Introduction: The fundamental structural and operational component of heredity is a gene. DNA is the…

Q: g Toll-like receptor

A: Macrophages work as innate immune cells through phagocytosis and sterilization of foreign substances…

Q: Refer to the following illustration to answer the question. O protein A is not made because it is…

A: There are some substances (protein, carbohydrate etc) which regulates the expression of genes. For…

Q: How do macrophages, granulocytes, and lymphocytes work together to locate, recognize, and eliminate…

A: The immune system is a vast network of the body's specialised organs, cells, and tissues that play a…

Q: Completely pubescent (60 hairs/cm³)? Intermediate pubescent (30 hairs/cm)? With 40 hairs/cm²?…

A: Polygenic traits are characteristics controlled or influenced by more than two genes. The genes have…

Q: 5. Very happy Escherichia coli cells reproduce on a 20 minute time frame (doubling or generation…

A: Bacteria are ubiquitous microscopic prokaryotic organisms which exhibit 4 different stages of growth…

Q: Explain the similarities and differences between the green and brown food webs. How are they…

A: A green food cycle (in the outer cove) and a brown food cycle (in the inner cove). The greenland…

Q: batches of competent cells into electrocompetent cells for transformation. In the end, the competent…

A: We know that transformation is the alteration of cell by introducing foreign genetic material into…

Q: What if three genotypes have different fitness levels, so that both kinds of homozygotes are more…

A: Fitness is a quantitative measure of individual reproductive success. It is also equal to the…

Q: Photosynthesis A. is the only energy-generating pathway for plants, cyanobacteria, and algae. B.…

A: Photosynthesis is a process that plants and other organisms use to convert light energy into…

Q: Type of infection for the following and small info about them: E. Balantidiasis F. Sleeping…

A: Introduction An infectious disease brought on by parasites is referred to as a parasitic disease,…

Q: Please explain Androgen Insensitivity Syndrome (ALS). What is the phenotype of these individuals?…

A: The common etiology of aberrant sexual development, androgen insensitivity syndrome, results in a…

Q: c. Questions 1. Which wavelengths of light are best absorbed by the chlorophyll extract? 2. Which…

A: Since there are multiple questions in this particular question, I will answer the three subparts for…

Q: A woman diagnosed with early-onset Alzheimer's due to a mutation of the APP genehas children with a…

A: Azheimer's disease (AD) is a neurodegenerative disorder characterized by progressive dementia and…

Q: The trigger for an action potential is:

A: The potential difference across a membrane is known as the Membrane Potential. Frequent, rapid…

Q: what is gor

A: GOR method was developed in the late 1970s.

Q: For the symbiotic relationship between termites and protozoa - the termite provides a favorable…

A: There are different type of relationship between microbes and others parasites or animals that can…

Q: 1. Show the different kinds of gametes which can be formed by individuals of the following…

A: Genotype is genetic makeup of organism. So, in this question we need to determine the gametes from…

Q: O C a. b. Ú Rate of Reaction d. of Reaction Rate of Reaction Rate of Reaction 100 Temperature (C)…

A: Given are four graphs depicting the relationship between rate of reaction and temperature. The best…

Q: What is ecology?At what different levels do ecologist study ecology? Define and describe each level…

A: Introduction All the organisms and the environment they interact with make up an ecosystem. The…

Concept explainers

Modes of Nutrition

It is a biological process of providing or obtaining food that is necessary for growth and health. It includes many physiological processes - absorption, ingestion, assimilation, catabolism, excretion, etc. In biology, the science that deals with nutrition's physiological and chemical processes are called "nutritional science."

Question

100%

Does cellular respiration occur in the cytoplasm or in the mitochondria? Explain and answer in digital format
Make schematics and diagrams

Definition Definition Set of metabolic processes and reactions that produce energy from organic substances such as glucose. Cellular respiration takes place in the organism’s cells, where the chemical energy from nutrients or molecules of oxygen is converted into adenosine triphosphate (ATP). Cellular respiration that occurs in the presence of oxygen is called aerobic respiration; in the absence of oxygen, it is called anaerobic respiration.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1 introduction

VIEW

Step 2 answer

VIEW

Step 3 diagram

VIEW

Step by step

Solved in 3 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Describe the characteristics of the mitochondria and chloroplast that separates them from organelles in the endomembrane system. NOTE: Please add references or citations from different sources.
Explain the mitochondria and its major functions along with diagram?
Compare the function and structure of mitochondria and chloroplast in detail
Describe two common characteristics of chloroplasts and mitochondria. Consider both function and membrane structure.
Below is a diagram of the cross section of a mitochondrion. Fill in the blanks by choosing words from the Word Bank. Word Bank. Stroma membrane Electron Transport Chain accumulation site The structure at A is The process occurring at C is H+ ******** ADP H* H* ATP Chemiosmosis H+ The area at E is (E) ATP synthase Inner membrane NAD+ + H+ Matrix H* B H+ Vacuole FADH₂ NADH H* Citric acid cycle FAD + 2H+ The structure at B is H* Cyt c Stomate H* Calvin Cycle 1/20₂ + 2H+ Intermembrane space The sequence of events at D is H* H₂O A Outer 0000000000 Proton
Note : — don't copy in google or bartleby. Plagarize checker will be used. QUESTION : — Why is it necessary for a mitochondrion to have many infoldings ? — What will happen if mitochondrion has few to no infoldings at all ?
Which part of cellular respiration produces the most ATP? Concisely describe how that process works.
Where does the process of cellular respiration occur? mitochondria endoplasmic reticulum nucleus chloroplasts
Using the answer code on the right, indicate which form of energy production is being described: 1. takes place in the mitochondrial matrix 2. produces H2O as a by-product 3. results in a rich yield of ATP 4. takes place in the cytosol 5. processes acetyl-CoA 6. takes place in the mitochondrial innermembrane cristae 7. converts glucose into two pyruvate molecules 8. uses molecular oxygen 9. accomplished by the electron transport system and ATP synthase (a) glycolysis (b) citric acid cycle (c) oxidative phosphorylation
Draw a simple diagram of a mitochondrion and identify its structural features.
From what organelle is this DNA isolated? ATCACGAGCTTAATTACCATGCCGCGTGAAACCAGCAACC Use BLAST to discover what the genus and species is and read the description of the first organism that is listed. mitochondrion chloroplast ribosome nucleus
Outline the structures and general functions of mitochondria andchloroplasts.