DOWNLO T O- : Tools 4. In your own words, write a brief description of the events that occur in each of the following organelles during the process of protein synthesis. In your answer, be sure to include the following terms: DNA, m RNA, TRNA, codon, amino acid, protein In the nucleus: In the ribosome:

Q: A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a mutation…

A: Nonsense codon The mRNA sequences; UAA, UAG, UGA signals the termination of the process of…

Q: Transcription Select an answer and submit. For keyboard navigation, use the up/down arrow keys to…

A: Transcription is the method of copying information from a strand of DNA into a new messenger RNA…

Q: Challenge #2: When you are given the amino acid, there are MULTIPLE possible MRNA and DNA codons,…

A: The DNA is transcribed into RNA by the process of transcription and then the RNA is translated into…

Q: 4) Membrane Structure Can you draw, label, and/or explain key components of a phospholipid bilayer?…

A: The lipid bilayer (also known as the phospholipid bilayer) is a polar membrane consisting of two…

Q: Understand the parts of a cell, how cells communicate, and the process of DNA mRNA protein and the…

A: Cells communicate with one another by secreting chemical messages such as neurotransmitters,…

Q: 13' 5' 13' + A represents spliceosome introns and B represents Group II introns A represents Group…

A: Exons can be defined as expressing sequences whereas introns can be defined as intervening…

Q: After an amino acid enters the cell, it can be used in which TWO of the following ways? (Must have…

A: An amino acid is an organic molecule consisting of a simple amino group (NH2), an acidic carboxyl…

Q: он он CH, CH, CH NH O-C 0-CH, Identify/Name the noncovalent interaction between groups in the…

A: Solution   " O " - Hydrogen bond   It is primarily electrostatic force of attraction between…

Q: Challenge #1: Can you go from MRNA back to DNA (and to the amino acids?) DNA CGA UUC CAG GUG UAA AAC…

A: mRNA is also called as messenger RNA which is a single-stranded RNA molecule complementary to the…

Q: First, let's determine the parts of the cell involved with making a protein: 1. Label the CELL…

A: Introduction :- Protein synthesis is a process in which cells make proteins in two stages.…

Q: AKS 5c1: Use the model below to answer the question that follows. Which interpretation of this model…

A: Cell is a structural and functional unit of living organisms. Several cells joined together to form…

Q: The spherical vesicles contain hydrolytic enzyme that can break down many kinds of biomolecules…

A: 1. Lysosomes : These are sphere shaped vesicles & contains hydrolytic enzyme that can break down…

Q: 33. Required The diagram below represents a portion of the cell membrane. HOME Y The structures…

A: Introduction  Proteins called "transport proteins" are responsible for moving materials across…

Q: The process by which base pairs combine with each other to form a strand of DNA is called _______.…

A: DNA is composed of four types of nucleotide, adenine, guanine, thymine and cytosine. Adenine pair…

Q: Lab 7: Protein Synthesis B. The DNA code for the A chain of insulin Below is the DNA base sequence…

A: Introduction  The process through which a gene's information is used to produce either RNA molecules…

Q: Question 6 of 10 Categorize each of the following descriptions as MRNA, FRNA, or tRNA. NOTE: Some…

A: Ribonucleic acid (RNA) is a vital biological macromolecule found in all living organisms. It is…

Q: 1. Centrioles are only found in cells. They function in cell They have protein fibers. Draw a…

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…

Q: Which of the following is not a factor in the lifetime of a protein? ANSWER Ubiquitination…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: Use the diagram provide below to trace the steps involved in protein synthesis and exocytosis in a…

A: DNA encodes the genetic information, this information through Central Dogma passed on from DNA to…

Q: When pieces of DNA that were not originally from a bacterial cell get integrated into its…

A: Introduction :- Bacteria are prokaryotic organisms . They do not have a well defined nucleus and…

Q: 13. Insulin, a biological macromolecule (a protein), is a polymer produced by the beta cells of the…

A: *insulin is a protein consisting of two polypeptide chains, A chain and B chain,linked together by…

Q: 6. Emtriva acts as a nucleoside analog reverse-transcriptase inhibitor (NRTI). Here is a drawing of…

A: Bond line structures are a way of representing chemical structure. There are few considerations…

Q: Which of the following experiments suggested DNA was the transforming principle? O Avery, MacLeod,…

A: As per our honor code, we are authorized to answer one question at a time, since you have not…

Q: Task 3: Place the following events of protein synthesis in order. 1 RNA polymerase attaches to DNA 2…

A: The process through which cells create proteins is known as protein synthesis. Transcription and…

Q: 6. The DNA sequence of a portion of the TEMPLATE strand of a gene is 5'-CAATACGTAC-3'. A. Write the…

A: The Central Dogma theory, in Genetics, states that DNA makes DNA through Replication. DNA makes RNA…

Q: ATP and GTP play a few roles during transcription and translation. What are two roles that ATP plays…

A: ATP and GTP have different roles during Transcription and translation.

Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…

A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…

Q: Molecular Biology (Biol-L211) Dr. Nole Central Dogma Practice - Processes The general flow of…

A: The replication, transcription and translation are the very important processes in cell biology that…

Q: 2. In DNA, what nitrogen base always binds with A? G? 3. How is mRNA different from DNA?. 4. In…

A: DNA molecule is composed of simple monomeric units termed nucleotides, which are joined together by…

Q: Consider the image of protein synthesis (translation). Identify the two different RNA molecules…

A: Translation refers to the process of protein synthesis. It falls under the process of gene…

Q: 8 7 2 6. 3 4 000 000 DO0

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: Complete the sentence using one of the choices: A gene is a region of DNA that contains triplet…

A: DNA:  Deoxyribonucleic acid (DNA) is a polymer made of two polynucleotide chains that coil around…

Q: Task 2: Review the process of protein synthesis by placing the cards in their appropriate category.

A: The protein synthesis is the anabolic process of the synthesis of the protein by the polymerization…

Q: microfilaments, microtubules, intermediate filaments

A: Microfilaments is  actin filaments, the protein filaments in the cytoplasm of eukaryotic cells that…

Q: Exercise 1 The order of a molecule of mRNA is given like following. b. AAAUGUCAAACGAGGCCGAUCAUUAAACU…

A: Translation is the process where protein (amino acids) is synthesized from mRNA molecule that is…

Q: Silent mutation: Single substitution mutation when the change in the DNA base sequence results in a…

A: A mutation is defined as the change in the sequence of DNA of a cell in organisms or viruses. These…

Q: délivery/start/5381544436?action3Donresume&submissionld=648298410 POSSIB Eukaryotic cells are more…

A: INTRODUCTION Prokaryotes These are smaller organisms which are less complex than Eukaryotes.

Q: Question 1: Answer all practice question parts Label the leading and lagging strands below: 3' Label…

A: DNA is a genetic molecule which undergoes replication and is required for protein synthesis.

Q: Step 2- Translation o Function: Pieces of RNA make o Location: In the o There are different types of…

A: TranslationThe method by which a corresponding protein is constructed using the information carried…

Q: Which of the following is a possible reason that the cell makes RNA as an intermediate to protein…

A: Asked : Given option which is correct regarding protein synthesis

Q: State whether TRUE or FALSE. Explain your answer   Reverse transcription occurs naturally in the…

A: Reverse transcription is mainly an event in which RNA is converted into c-DNA.This is mainly done by…

Q: 1) Why can the genome be thought of as life's instruction manual? 2) What is the difference between…

A: DNA is genetic material in most of organisms which carries genetic information and transfer it into…

Q: Both prokaryotic and eukaryotic cells have to synthesize proteins. Answer:

A: According to the question, we have to provide the name of the organelle which is found in both…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.