Answered: Does base stacking play any role in…

Science

Biology

Does base stacking play any role in stability of RNA (single-stranded)? Explain please!

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: It is conceivable for codons encoding a single amino acid to share the first two bases while…

A: Protein synthesis occurs in all organisms in two main steps: transcription and translation. DNA…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.

A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…

Q: includes

A: A new Covid, known as serious intense respiratory disorder Covid 2 (SARS-CoV-2), is the aetiological…

Q: Using the nucleotide sequence of an accession number (NM_019121) what is the translated amino acid…

A: Proteins are made up of amino acids. DNA is the genetic material that codes for the amino acids that…

Q: How many different sequence possibilities are there for a double-stranded RNA polymer that is 6…

A: At each base, one can have any of the four different bases (A,U,C or G). Therefore for the first…

Q: Write the detail or exact information of the following of molecule “X” with UniProtKB accession…

A: Hello, thank you for your question. As per our guidelines, I am answering only the first three…

Q: (d) Would there be an effect on translation of changing the fourth A in the template strand to a C?…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both

A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…

Q: What is the tagged specific structure

A: The picture shows an opened up ribcage of a carcass. spine or vertebral column could be seen running…

Q: What if the DNA is not a double helix, what is its implication? Explain and give example.

A: Deoxyribonucleic acid (DNA) is the genetic material present in the nucleus and cytoplasm of…

Q: Transfer RNA molecules are quite large, given that the anticodon consists of only three nucleotides.…

A: Proteins within the human body are made up of a small chain of building blocks, which are termed…

Q: . What is wobble base-pairing? According to Wobble's rule, one tRNA is sufficient to decode the…

A: Base pair is defined as two complementary nitrogenous that are connected by hydrogen bonds. Base…

Q: 3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched…

A: Transfer RNA or tRNA is defined as a molecule which helps to decode mRNA or messenger RNA into a…

Q: In the early days of molecular biology, some researchers speculated that RNA, but not DNA, might…

A: Molecular biology is the field of biology that studies the composition, structure, and interactions…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: Which anticodon would you predict for a tRNA speciescarrying isoleucine? Is there more than one…

A: A codon can be defined as the three-nucleotide sequence present on the DNA or RNA which codes for…

Q: The practical limit for the number of different RNA sequences screened in a SELEX experiment is…

A: SELEX stands for Systematic Evolution of Ligands by EXponential enrichment. It is a laboratory…

Q: What is the direct consequence of the hydrophobic effect that stabilizes the double helix

A: Approach to solving the question: Detailed explanation:In an aqueous environment, the hydrophobic…

Q: Are there other possible conformations of the double helix?

A: Introduction: DNA is a genetic material that transfers from one to another. It is a type of nucleic…

Q: What would you expect the functional properties of a riboswitch specific for the amino acid lysine…

A: All life is dependent on DNA. It contributes to the genetic code for life and its activities,…

Q: Discuss the structural significance of complementarity in DNAand in RNA.

A: Complementarity Complimentarity achived by interaction between these nitrogenous bases. DNA is…

Q: Lagging strand synthesis in prokaryotes leads to two main problems: 1. Presence of multiple RNA…

A: Lagging strand synthesis in prokaryotes The polymerase 3 catalyses the synthesis of both the…

Q: What is the numeric relation between pyrimidine and purine bases in the DNA molecule? Is that…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the…

A: Fos-jun family proteins are a class of proteins that belong to a large group of DNA binding proteins…

Q: Draw the molecular structure of a looped RNA with 10 nucleotides, from 3' to 5': AUCGUCGGAU, show…

A: A DNA strand is made up of three parts: Nitrogenous Bases Deoxyribose Sugar Phosphate group They…

Q: What are the FOUR(4) distinct steps of translation elongation cycle for a growing polypeptide chain?

A: The translation is the process of protein synthesis from the genetic codon present in the mRNA. This…

Q: Which of the following regarding RNA secondary and tertiary structure is false? Coaxial stacking is…

A: Introduction The secondary structure of RNA is made up of stem loops and hairpins and they are…

Q: Why do you think the motif of the DNA-binding protein shown is called a zinc-finger motif?

A: Each protein has unique features. However, most bind to DNA as homodimers or heterodimers and…

Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…

A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…

Q: To become functional, newly synthesized RNA must undergo a series of maturation steps such as…

A: According to the central dogma of molecular biology, the information stored in the DNA is first…

Q: What would you expect the functional properties of a riboswitch specific for the amino acid lysine…

A: Riboswitch is a gene sequence present on mRNA, which regulates the protein synthesis by binding to a…

Q: Considering how readily RNA folds to form a secondary structure, why isn’t it used to store genetic…

A: Answer: 1)Despite its propensity to easily create secondary structures, RNA is not the preferred…

Q: Suppose your supervisor is working on a molecule “X” with UniProtKB accession number P18564. Being a…

A: As per the honor code, we answer only three subparts at a time, therefore, we are answering the…

Q: The nucleoside inosine frequently occurs as the third base in codons. What role does inosine play in…

A: Inosine is the nucleoside made up of ribose and hypoxanthine.

Q: What is a key reason reason for the versatility of RNA?

A: All living cells contains ribonucleic acid (RNA) nucleic acid with abilities similar to those of…

Q: If an RNA molecule could form a hairpin with asymmetric internal loop, as shown in Figure Q6–5,…

A: The nucleic acid is a significant macromolecule found in all living organisms. The molecule is…

Question

Does base stacking play any role in stability of RNA (single-stranded)? Explain please!

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Why RNase H cannot remove all the RNA residue from Okazaki fragments to form a lagging strand? Explain.
What can we most-accurately say about the polypeptide with the primary sequence KNEADING? a.It has two acidic R groups b.It has three basic R groups c. It has two nonpolar neutral R groups d. It contains three polar neutral R groups e. It contains a disulfide linkage
Diagram the likely secondary structure of an RNA with the sequence
What evolutionary benefit can RNAi provide?
Hydrogen bonds are usually 2.7-3.3 angstrom long. According to this information, do you think there is a direct hydrogen bonding between H840 and the phosphodiester bond that links dG13 and dT14 (Chain C)? If not, what is the key role of H840 in Cas9?
On your scrap paper, please draw a RNA secondary structure that has the following structures: (1) Two stem-loops (2) One asymmetric internal loop (3) One 4-way junction Please be sure to label.cach type of secondary structure on your drawing In the window below, describe which structures in your RNA molecule make the structure more stable, and why. Please answer in 4 sentences or fewer.
Can the side-chain of glutamine make a bidentate interaction in the major groove at a G-U wobble base-pair found in an A-form RNA duplex? Explain your answer.
An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mu- tants induced by proflavin, a dye with a planar structure that can intercalate (fit) between successive base pairs in DNA and induce frameshift mutations- that is, mutations involving additions or deletions of a single base. Streisinger and colleagues found that a particular single-base insertion mutation could be suppressed, with wild-type function restored, by a mutation that evidently involved a single-base deletion at a nearby site. Shown below are portions of the amino acid sequence of wild-type T4 lysozyme and the putative double mutant. The remaining parts of the sequence were unchanged. Identify MRNA sequences that could encode each of these amino acid sequences and deter- mine whether your codon assignments are consistent with the genetic code. Wild-type ... Lys-Ser-Pro-Ser-Leu-Asn-Ala. .. Double mutant - ..…
6
34) What amino acid sequence is coded for by the following DNA coding strand? (Recall: the DNA template strand runs 5' to 3' and the mRNA strand runs antiparallel to the DNA template strand. Recall that DNA is translated with a start codon.) 5'-TTATGCGACCAGACCAGTTT-3' Coding strand