Answered: Does base stacking play any role in…

Science

Biology

Does base stacking play any role in stability of RNA (single-stranded)? Explain please!

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Related questions

Q: What are translation with examples?

A: The translation is a process through which the polypeptide chain is synthesized based on the…

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.

A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…

Q: Using the nucleotide sequence of an accession number (NM_019121) what is the translated amino acid…

A: Proteins are made up of amino acids. DNA is the genetic material that codes for the amino acids that…

Q: Write the detail or exact information of the following of molecule “X” with UniProtKB accession…

A: Hello, thank you for your question. As per our guidelines, I am answering only the first three…

Q: Which type of RNA has the least amount of secondary structure? Explain

A: Ribonucleic acid (RNA) is considered an important biological macromolecule present in all cells to…

Q: In describing the triplet binding assay, an undergraduate with limited knowledge of translation…

A: Every three nucleotides in a row count as a triplet in the genetic code and codes for a single amino…

Q: Why did Okazaki propose that lagging strand synthesis proceeds through the synthesis of short…

A: The effective copying of double-stranded chromosomal DNA is required for cellular DNA replication.…

Q: (d) Would there be an effect on translation of changing the fourth A in the template strand to a C?…

A: The terms used in the question represents the molecules used during a gene expression. A gene is a…

Q: What molecular biology strategy can best be used to determine Failure of t-RNA to bind at the A site…

A: In prokaryotes, transcription and translation occur simultaneously as generation time is 20…

Q: The Shine-Dalgarno Sequence is used in bacteria eukaryotes both

A: The nucleotide segment at the 3' terminal of 16S ribosomal RNA (rRNA) has several pyrimidines with a…

Q: What is the tagged specific structure

A: The picture shows an opened up ribcage of a carcass. spine or vertebral column could be seen running…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: What if the DNA is not a double helix, what is its implication? Explain and give example.

A: Deoxyribonucleic acid (DNA) is the genetic material present in the nucleus and cytoplasm of…

Q: Transfer RNA molecules are quite large, given that the anticodon consists of only three nucleotides.…

A: Proteins within the human body are made up of a small chain of building blocks, which are termed…

Q: What are the detail or exact information of the following of molecule “X” with UniProtKB accession…

A: UniProt stands for, universal protein resource . its a digital platform that has vast, curated,…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…

A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…

Q: The practical limit for the number of different RNA sequences screened in a SELEX experiment is…

A: SELEX stands for Systematic Evolution of Ligands by EXponential enrichment. It is a laboratory…

Q: Why are GC and AT the only base pairs permissible in the double helix?

A: Base pair: The nucleotides on opposite strands of DNA double helix, that form chemical bonds…

Q: how do you translate this sequence RNA A C U G U C A U G A G C C C U G C A…

A: Translation is the process by which proteins are synthesized by the ribosomes after the process of…

Q: The following RNA: 5 AUGAUAACACUCGUACCUUAAUGUS' in the 5'-3'frame will betranslated into a peptide…

A: The single-stranded ribonucleic acid (RNA) molecule that corresponds to the genetic sequence of a…

Q: What is the numeric relation between pyrimidine and purine bases in the DNA molecule? Is that…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: An important validation of the genetic code occurred when George Streisinger determined the amino…

A: It is given that the specific single-base insertion mutation could be suppressed, with wild-type…

Q: What are the FOUR(4) distinct steps of translation elongation cycle for a growing polypeptide chain?

A: The translation is the process of protein synthesis from the genetic codon present in the mRNA. This…

Q: Explain the interactions of specific tRNA with its synthetase, by including the importance of…

A: Answer) Cloverleaf structure of tRNA: It is formed due to the intramolecular hydrogen bonds and…

Q: The overall structures of RNA polymerase and DNA polymerase are very different, yet their active…

A: DNA polymerase help in DNA replication whereas RNA polymerase help in transcriptions. Both have…

Q: In the absence of cladosporin, explain the elongation steps in the synthesis of lysyl-tRNA…

A: DNA is the preferred carrier of genetic information in almost all organisms barring RNA viruses. DNA…

Q: You are characterizing a DNA-binding protein, and have used genetic experiments to identify a domain…

A: Proteins have a secondary structure which is 3D one and the two most common of these are the alpha…

Q: List three types of noncoding RNA and describe theirfunctions.

A: RNA is a ribonucleic acid that helps within the synthesis of proteins in the body. This nucleic acid…

Q: Considering how readily RNA folds to form a secondary structure, why isn’t it used to store genetic…

A: Answer: 1)Despite its propensity to easily create secondary structures, RNA is not the preferred…

Q: What is the order of the polypeptide chain shown in the images provided? Starting at the…

A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…

Q: Suppose your supervisor is working on a molecule “X” with UniProtKB accession number P18564. Being a…

A: As per the honor code, we answer only three subparts at a time, therefore, we are answering the…

Q: Draw the structure of double standard polynucleotide chin?

A: The DNA (deoxyribonucleic acid) is the genetic material of the cell that is inherited by the…

Q: If an RNA molecule could form a hairpin with asymmetric internal loop, as shown in Figure Q6–5,…

A: The nucleic acid is a significant macromolecule found in all living organisms. The molecule is…

Question

Does base stacking play any role in stability of RNA (single-stranded)? Explain please!

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Why RNase H cannot remove all the RNA residue from Okazaki fragments to form a lagging strand? Explain.
What can we most-accurately say about the polypeptide with the primary sequence KNEADING? a.It has two acidic R groups b.It has three basic R groups c. It has two nonpolar neutral R groups d. It contains three polar neutral R groups e. It contains a disulfide linkage
Diagram the likely secondary structure of an RNA with the sequence
DNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCC
What are the two functional ends of transfer RNA and how do they work to accomplish these functions? Draw a simple figure illustrating the molecule and label these “ends.”
What's the difference between moderately repetitive & highly repetitive sequences of eukaryotic sequences? Can someone give some examples of each?
Can the side-chain of glutamine make a bidentate interaction in the major groove at a G-U wobble base-pair found in an A-form RNA duplex? Explain your answer.
Given the following diagram of how protein AWESOME1 binds to it's target DNA, describe the potential effects of each of the 5 mutations shown below. The wild-type sequence of a helix #1 is also shown in the blue box, and all the mutations are in helix #1 (see numbers for identifying particular residues). a helix #1 R(1)-V-I-L-Y-F-W-I-M-Y-F-S-H-Y-W-R(16) #1 Predict the consequence of the following mutations: 1) Arg(1) to Glu 2) Arg(1) to Ala 3) Phe(6) to lle 4) Trp(7) to Phe 5) Met(9) to Pro in
An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mu- tants induced by proflavin, a dye with a planar structure that can intercalate (fit) between successive base pairs in DNA and induce frameshift mutations- that is, mutations involving additions or deletions of a single base. Streisinger and colleagues found that a particular single-base insertion mutation could be suppressed, with wild-type function restored, by a mutation that evidently involved a single-base deletion at a nearby site. Shown below are portions of the amino acid sequence of wild-type T4 lysozyme and the putative double mutant. The remaining parts of the sequence were unchanged. Identify MRNA sequences that could encode each of these amino acid sequences and deter- mine whether your codon assignments are consistent with the genetic code. Wild-type ... Lys-Ser-Pro-Ser-Leu-Asn-Ala. .. Double mutant - ..…
Why does the sequence ITLIIFGVIAGVIGTILLI more likely to contain a membrane-spanning sequence?
In your own words, explain why 5’-CG-3’ dinucleotides are much rarer than we expect them to be in our genome.
6