Q: What do you mean by DNA polymerase δ?
A: Introduction: DNA polymerase δ is one of the multiple types of DNA polymerases found in eukaryotes.
Q: What do you mean by replication origin in DNA Cloning?
A: A"clone" simply means that an object, cell, or whole organism has the same genetic makeup as the…
Q: Why DNA repair systems is important ?
A: DNA is the genetic material that carries information from parents to offsprings. DNA in a cell can…
Q: Can we change our DNA?
A: DNA- deoxyribonucleic acid is the molecule that carries instructions essential for an organism to…
Q: In your opinion, what is one piece of scientific research that made it possible to understand DNA's…
A: The one piece of scientific research that made it possible to understand DNA's structure or function…
Q: What did Pauling and Corey discover about DNA?
A: Cell is an elemental unit inside the body in which numerous metabolic activities takes place . It…
Q: Which of the following is considered a "palindrome" in DNA? O GGATCC O AATTAA O CGATAGC
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Do most cells contain complete copies of an organism’s DNA? Do most cells express all of the genes…
A: Genome is composed of all the genes present in an organism present in the nucleus. A genome can be…
Q: Can we manipulate DNA?
A: Gene manipulation is a process to edit genome of a target organism to get desired trait. It involves…
Q: Cells have only one fundamental wayof replicating DNA but many differentways of repairing it. Are…
A: DNA is the genetic material present in the cells of living beings.
Q: Name three important functions of DNA.
A: DNA is deoxyribonucleic acid which acts as genetic material in all organisms present on Earth. DNA…
Q: do each strand of DNA have equal number of phosphate group
A:
Q: What do you mean by DNA Repair and Recombination?
A: Introduction DNA is highly prone to mutations too which can be either spontaneous or can be caused…
Q: What forms the chemical code within a molecule of DNA? O The arrangement of the sugars and bases O…
A: Option C is correct.
Q: As a result of the Human Genome Project, we learned that approximately % of "junk" DNA is actually…
A:
Q: Why does dna polymerase only extend previously existing nucleotides
A: DNA polymerase is an enzyme that synthesizes DNA molecules from deoxyribonucleotides.
Q: Clearly, all humans have variations in their DNA sequences. How is it possible to sequence the human…
A: Answer- All the organism have certain amount of similarities in the DNA sequnece. In all the human…
Q: Why do we study the DNA sequence of human organism?
A: Biomolecules are the organic molecules present in living organisms. Carbohydrates, proteins, nucleic…
Q: What do you mean by bacteriophage?
A: Viruses can affect only specific species of hosts and only particular cells in that host. The virus…
Q: E14. A sample of DNA was subjected to automated DNA sequencing and the output is shown here. WWww…
A: DNA Sequencing is the technique to determine the order of the nucleotides within the DNA…
Q: Which of these molecules links the most of the individual DNA nucleotides together on the newly…
A: ENZYME:- It is defined as a complex biological catalyst i.e produced by a living organisms in its…
Q: What evidence do you have that RNA came before DNA?
A: There is a major difference between RNA and DNA which makes DNA more stable than RNA. Being more…
Q: DNA: The Secret of Life What did some think Peter Pauling was? Why?
A: Peter Pauling was a scientist. Peter Pauling was the son of Linus Pauling, a great chemist, who won…
Q: then he has to chop it up Dr. A. Zion wants to study the flight gene of birds. In order to study the…
A: Information Given: Zion wants to analyse DNA sample of a bird from it's flight gene 1st blank: First…
Q: What do you mean by DNA?
A: Every organism is made up of the smallest unit of life i.e. cell which includes many cell organelles…
Q: true or false: a nucleotide’s 5 end provides the energy to synthesize a new strand of DNA.
A: Replication is one of the essential properties of genetic material because the progeny cells should…
Q: To test you further whether you understand the processes involved in the Central Dogma of Molecular…
A:
Q: Can you think of any difference between DNAs and DNase?
A: Genetic information is stored in nucleic acids. There are two types of nucleic acid found in a cell…
Q: What type of mutation can we get if we use phones and laptops too much
A: Phones and laptops are widely used gadgets nowadays . These devices emit the harmful electro…
Q: Why does every cell in our body contain DNA?
A: DNA is deoxyribonucleic acid which acts as genetic material in all the organisms. It is located in…
Q: What does alphabets G,S,A,T in regards to DNA
A: Deoxyribonucleic acid (DNA) stores the cell’s genetic information and is present in the nucleus of…
Q: What would happen if you replaced all the negative charges on DNA with positive charges? What would…
A: DNA is the naturally negatively charged macromolecule. The DNA is associated with a protein or…
Q: Why do you think DNA is the genetic material used by eukaryotes instead of RNA?
A: Deoxyribonucleic acid (DNA): Nucleic acids are molecules that store hereditary information for…
Q: Why Are There So Many DNA Polymerases?
A: DNA polymerases are the sole enzymes which duplicates the genetic information in the nucleic…
Q: Below is the sequence of a single strand of a short DNAmolecule. On a piece of paper, rewrite this…
A: Cells are the most fundamental and essential unit of life in all living things. All of life's…
Q: What is a DNA Ladder? a solution added to a DNA sample to give it color for an electron microscope.…
A: DNA: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…
Q: Uniquely describe the chemical and physical structure of DNA in your own words.
A: DNA or deoxyribonucleic acid which are made up of molecules known as Nucleotides where each…
Q: Do you think DNA deserves all the glory accorded to it as the fundamental unit of the genome?
A: DNA or Deoxyribonucleic acid is one of the two classes of Nucleic acids. Two types of nucleic acids…
Q: Blue prints of body design are stored in the DNA. Why?
A: Genetic material is the medium through which genetic information passes from a parent cell to its…
Q: Vho first developed the DNA sequencing approach using dideoxynucleoside triphosphates in DNA…
A: DNA was major topic of discuss in early times for scientists. It's structure and constituents…
Q: Why is it important for scientists to be able to isolate DNA?
A: DNA extraction is the isolation of DNA from biological samples. Most DNA extraction protocols…
Q: If you eat DNA all the time, why aren’t you harmed by it? What implication does this have on the…
A: DNA or deoxyribonucleic acid is the genetic material found in all cells. It carries the coded…
Q: how to extract DNA from everything
A: Extraction of DNA from a specimen is a process by which nuclear DNA can be extracted from the cell…
Q: Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will…
A: BamHI is a type II restriction endonuclease that can recognize short DNA sequences (6 bp) and cleave…
Q: Which nitrogenous base correctly pairs with adenine on the DNA strand during replication? O uracil O…
A: -the adenine pairs with thymine.
Q: Answer the following question briefly but intelligently. 1.) In your perspective, with the…
A: Genetic Engineering : It is the process of using recombinant DNA technology to alter the genetic…
Q: Besides replicating DNA, what is another function of DNA polymerase? O protein synthesis O…
A: The DNA (deoxyribonucleic acid) is the hereditary unit of an organism. The genes consist of the DNA…
Q: If life were found on another planet, do you think that itwould have the same genetic code? Justify…
A:
Do you think DNS deserves all the glory accorded to it as the fundamentals unit of the genome?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What life experiences can someone havethat might coil or uncoil your DNA?What do you mean by DNA?Numbering the fragments left by cutting the DNA with BAM HI from left to right, which fragment will travel the furthest? BAM HI: GGATCC CCTAGG AATCGGATCCATTTGGACTAAAGGACCCGGATTGGATCCAGGGCCTTTAGTACC TTAGCCTAGGTAAACCTGATTTCCTGGGCCTAACCTAGGTCCCGGAAATCATGG O 3 O 2 4. 1.
- A particular triplet of bases in the coding sequence of a DNA strand is AGT. What is the corresponding triplet in the complementary strand of 2 points DNA? O AGT О ТСА O UCA O UGT Poovor tf ho coulLfind the ler Gregor Mondolcovnorimontc couab 9MOWhy does every cell in our body contain DNA??What does alphabets G,S,A,T in regards to DNA
- Who was responsible for the X-ray crystallography that determined the shape and structure of DNA? O Rosalind Franklin O Heinz Fraenkel-Conrat and Bea Singer O Frederick Griffith O James Watson and Francis Crick O Alfred Hershey and Martha ChaseWhy is DNA so importantIn your opinon, what researcher(s) made it possible to understand DNA and how did their scientific research contribute to genetics?
- What percentage of our DNA do you think is the same in all humansIf I'm any organism a dna molecule is 24% cytosine, how much adenine will that dna molocule contianWhat forms the chemical code within a molecule of DNA? O The arrangement of the sugars and bases O The arrangement of the phosphates and sugars O The arrangement of the nitrogen bases O The arrangement of the chromosomes