Answered: DNA The substance represented by the…

Science

Biology

DNA The substance represented by the scissors shown cutting the DNA is

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter14: Dna Structure And Function

Section: Chapter Questions

Problem 1VCQ: Figure 14.10 In eukaryotic cells, DNA and RNA synthesis occur in a separate compartment from protein...

See similar textbooks

Related questions

Q: The enzyme used to join bits of DNA isa) DNA polymeraseb) DNA ligasec) Endonucleased) Primase

A: The process in which deoxyribonucleic acid (DNA) forms the its copy during cell division is known as…

Q: Fill in the table. Nucleic Acid Comparison DNA ml

A: Nucleic acid- It is an macromolecule found in all type of cell. In other word you can says that…

Q: DNA Extraction using Tomato DNA Extraction by Mouthwash

A: DNA extraction is a technique for isolating DNA from cell membranes, proteins, and other biological…

Q: Joining two DNA molecules using DNA ligase. Ligation. O Adhesion. Linker Linkage.

A: DNA fragment is joined with another DNA fragment by the formation of phosphodiester bond. Enzyme…

Q: DNA Fingerprints Cat Kittens IL || ILL || I I

A: DNA fingerprinting is a technique used to compare sequences in genomes using satellite DNAs like…

Q: Word bank: Uracil Ribose R. Double-stranded Deoxyribose Thymine Single-stranded Made up of…

Q: The enzyme responsible for separating double-stranded DNA intosingle-stranded DNA isa. DNA…

A: Genetics is a piece of science worried about the assessment of genes, genetic collection, and…

Q: A strand of DNA has the base sequence 5' GTAACC 3'. Write the base sequence for the complementary…

A: The nitrogenous bases of DNA are adenine, guanine, cytosine, and thymine. Adenine and guanine are…

Q: Normal Strand: DNA: GCA ATG CAC MRNA: Amino Acids:

A: A frameshift mutation is a genetic mutation. It is caused by indels of the number of nucleotides in…

Q: Describe and diagram the DNA damage done by UV radiation on a single strand of DNA. Describe in at…

A: The DNA molecules that encode its genome in human cells DNA damage is subdivided into two types:…

Q: Primer needed to initiate DNA replication is A) DNA segment B) RNA segment C) DNA-RNA hybrid D)…

A: INTRODUCTION Primers are short segment of RNA which act as a starting point for DNA replication.

Q: DNA scissors used in genetic engineering applications are called Endo nucleases Restriction enzymes…

Q: Single strand as a template plus 3' end to start DNA synthesis но- Polymerase works, DNA synthesis…

A: Addition of bases to the primer occurs as DNA replication proceeds :-

Q: Please draw the structure of DNA and label the parts. Thank you very much for your help

A: Deoxyribonucleic acid (DNA): DNA is a type of molecule known as nucleic acid. It is the blueprint…

Q: The _____________ strand is made continously.

A: DNA replication in eukaryotes is semiconservative, semicontinuous, and bidirectional. It occurs in…

Q: True or False: Polymerases open the DNA and create the replication bubble while helicases run…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains which wrap around one…

Q: •DNA structure •DNA isolation •DNA isolation methods DNA purification urifi

A: DNA, or deoxyribonucleic acid, is the genetic material in people and in other remaining life forms.…

Q: DNA polymerase replicates DNA producing a _______ strand.

A: Answer: DNA polymerase replicates DNA producing a new complementary strand. Explanation: Duplication…

Q: Complementary DNA

A: DNA stands for deoxyribonucleic acid. It is a kind of genetic material.

Q: Compare to the original double helix, evaluate the copies made during three attempts of DNA…

A: DNA has a double stranded structure. During DNA replication, the DNA double helix unwinds & each…

Q: - sequence is there an error in the DNA

A: The advent of technology has lead to discovery of structure of DNA by Watson and Crick in 1950. This…

Q: During dna electrophoresis.....fragments migrate toward the..... electrode fasterthan…

A: Gel Electrophoresis is a widely used technique in molecular biology and biotechnology in which…

Q: which of the chemicals in the process removes the proteins from the dna

A: Deoxyribonucleic acid is an atom made out of two polynucleotide chains that loop around one another…

Q: If DNA polymerase makes an error during copying it creates a ________ in the DNA.

A: Question - If DNA polymerase makes an error during copying it creates a ________ in the DNA.

Q: ENE 2: Nose Style DNA Template Strand ATG- GGG- CTT- CTC- TTT MRNA tRNA Amino Acids APPEARANCE

A: Above table is codon anti-codon table for translation of DNA code into protein sequence.

Q: uring DNA replication the synthesis of the leading strand of DNA results in fragments known as:…

A: During cell division, DNA replication is the process by which DNA duplicates itself. A replication…

Q: DNA figure

A: DNA is the genetic material of approximate all living organisms, the structure of the DNA is very…

Q: ntroduction to a report on the extraction of DNA using the technique of salting out method.

A: DNA molecule is the larger molecule that consists of a chain of nucleotides which was organized in…

Q: The enzyme that removes the RNA primer from the Okazaki fragment is: DNA pol III DNA ligase…

A: Introduction: DNA is the hereditary material that defines every cell. It is found within the nucleus…

Q: DNA pol 3's inability to begin the replication process is solved by which enzyme? helicase primase…

A: DNA is genetic material in most of organisms . It act as template for synthesis of its own . This…

Q: True or False: DNA can be copied outside a living cell. ___________

A: Dna is the genetic material and dna replication is the process where copies of dna are formed and it…

Q: Draw an Illustration of the steps and other methods involved in recombinant DNA ( Please make it…

A: Recombinant DNA is a type of DNA that is made up of sequences from various sources. The steps in the…

Q: DNA Sample : Blood Stain collected from handle of knife blood Bob Sue John Lisa stain 1. What do you…

A: Hereditary information is carried by DNA from one generation to another for the existence of life.…

Q: DNA can be electrophoresed. all cells have RNA. DNA polymerase will replicate any bacterial DNA. all…

A: PCR is short for Polymerase Chain Reaction.

Q: Show the replication strands in each of these bubbles (note they have different DNA orientations).…

A: DNA Replication Replication of DNA is a process of duplication of DNA, carried out by DNA…

Q: Below is a double stranded DNA molecule with a replication bubble. The filled lines represent the…

A: DNA replication refers to an enzyme-mediated complex process that produces replicate or copies of…

Q: Give the DNA compliment to the following DNA strand. GAA CTT a b. GAA CUU BRB

Q: missing word to complete the diagram. Replication Translation Proteins Transcription RNA DNA

A: It describes the normal flow of biological information: DNA can be copied to DNA ( DNA replication)…

Q: Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle…

Q: Write the DNA strand that is complementary to the strand shown below. Be sure to mark the ends of…

A: DNA is a polymer of nucleotides and a double-stranded molecule.

Q: The DNA ligase does NOT play any role in DNA replication DNA repair cutting DNA into fragments the…

A: DNA is one of the two nucleic acids made up of monomer units of nucleotides. DNA nucleotides are…

Q: Identify the component of the solution which is the extracted DNA

A: Everything living contains DNA. This DNA can be isolated for a variety of molecular biology…

Q: Why PCR needs the following: DNA template Primers DNA polymerase enzymes dNTPs Buffer Mg2+

A: Template:- There are several available methods for purification of RNA an DNA. While these are all…

Q: ent of DNA is usec ranscription. This

A: During DNA transcription DNA strand is transcribed into mRNA with the help of RNA polymerase. DNA…

Q: DNA replication is a semi-conservative process

A: In molecular biology, DNA replication is the process of synthesizing two identical copies of DNA…

Q: DNA polymerase l moves toward the direction of replication fork creating Okazaki Fragments. * True…

A: Most living organisms that are well defined in terms of that they have DNA as their genetic…

Q: In the figure, which ketter represents DNA polymerase 1 D AR AA BB C.C DD EE

A: Polymerase A kind of enzyme that make DNA or RNA from pre-existing DNA or RNA.

Q: DNA polymerase knows what nucleotide add next because it reads the ______________ strand.

A: DNA can add nucleotide to the end of 3rd strane only.

Concept explainers

Crime Scene Investigation

A crime scene refers to a place where a crime has occurred. The purpose of crime scene investigation (CSI) is to analyze the complete scene and catch the culprit based on the pieces of evidence collected from the place of crime. The people involved in this process are referred to as crime scene investigators.

Question

15. The diagram is a representation of a laboratory process.
DNA
The substance represented by the scissors shown cutting the DNA is
(1) an enzyme
(2) a carbohydrate
(3) a starch molecule
(4) a fat molecule

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

9) The diagram to the right represents one technique used in biotechnology. The organic compound used to cut the bacterial DNA so that the human DNA could be inserted a(n)
I am in Microbiology and the question is how would I turn the following DNA strands to primary protein structure? a. TACCCGGTCAAGGACTCCATT b. TTACCGGCTCCGAATGACTTTT
1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it up into codons. 3. Plug the codons into the amino acid chart to determine the correct amino acid needed to build that protein. 4. Identify the protein you made by comparing the sequence to the pictures 5. Answer the questions for each protein molecule you build before moving on to the next. Protein 1: DNA AAGACCGTATAC MRNA Amino Acid Sequence 1. Which kind of protein molecule did this gene make? 2. How does this protein help the body maintain homeostasis?
3. Use the 15 molecules illustrated below to answer the following question. Nucleotides consist of a 5-carbon sugar, phosphate, and nitrogenous base, which 3 images could be linked to form a nucleotide? (LS1-6) * 1. H. CHOH PHOLNHD 4. 6. HN- CH2 H-C-OH CH, HC-OH HO C-H HO-C-H HO OH SH O-P-O HO C-H H-C-OH OH H-C-OH H C-OH 3. H,C CH CH-CH 7. H-C H-C-OH H. C O C-O of CH CH CH CH 9. 0 H. H. 10. H CH CH HO-OH CH CH2 но CH HOOH CH H. H. CH HOO H CH CH 11. 13. NH, CH CH OH CH CH HC CH CNH CH 12. HOCH, o CH OH CH CH OH OH CH 14 15. CHOH CH,OH H. OH OH HO OH OH OH
What technique was used to photograph DNA in franklins famous photo #51? A- gamma ray photography B- atomic force microscopy C- electron microscopy D- x-Ray crystallography
Answer the following questions based on the given the sequence of nucleotides in a DNA molecule below: 5' T-C-A-G-T-C-A-G-C-A-A-C-G-C-A-T-G-A-A-A-T-G-C-C-T-T-T-C-A-T 3' 3' A-G-T-C-A-G-T-C-G-T-T-G-C-G-T-A-C-T-T-T-A-C-G-G-A-A-A-G-T-A 5 1. Which strand is the template strand, the first or second? 2. Write the base sequence of the MRNA that will result from the transcription of the template strand (indicate the 5' and 3' end) 3. Give the anti-codon of the first three TRNA that needs to be activated in the translation of the MRNA 4. Write the amino acid sequence of the polypeptide that will result after translation
Which of the following statements regarding DNA is false? Features a beta glycosidic bond between deoxyribose and nucleobase. Phosphoester bonds in DNA are extremely stable to non-catalytic hydrolysis. In B DNA the parallel stacks of nucleobases are separated by about 3.5 A A DNA is formed from single strands of RNA and DNA DNA contains uridine, adenosine, guanosine, and cytidine as nucleobases.
Why are nucleobases in nucleic acids called "bases"? 1. Because they resemble baseball bases 2. They are fundamental to "hodling up" the DNA structure (like the base of a building holds up the rest of the building) 3. They are the "command center" of the cell. Like the "base" of operations for armed forces in a war. 4. They are hydrogen ion acceptors, like other chemical bases
DNA Replication: 1. Write in the new (complimentary) strands for each of the two halves of the DNA molecule below to show what the two semi-conserved strands would look like. A G T A C C G G G C A A A C T G C A T T G T G I I I I I I I I I I I I I I I I I I I I I I I I I I T C A T G G C C C G T T T G A C G T A A C A C old strand A G T A C C G G G C A A A C T G C A T T G T G new strand: new strand: old strand T C A T G G C C C G T T T G A C G T A A C A C Gene Expression: 2. Use your DNA strand to construct a part of a messenger RNA molecule. DNA A G T A C C G G G C A A A C T G C A T T G T G mRNA:
Directions: Please fill the blank with the correct word/words that best describe/s the statement. (1) Are the basic structural unit of DNA and RNA. It consists _3., 4., 5; а 2., of 4 bases namely sugar and a phosphate group.
10. Your instructor has given you three test tubes, each containing a different unknown solution. After subjecting the unknowns to the tests described in today's lab, you have recorded the results in the following table. Identify the type of macromolecule (DNA, protein, starch, lipid, or reducing sugar) in each of the unknown solutions. Biuret Sudan IVType of molecule Benedict's lodine Unknown #1 blue Unknown #2 green Unknown #3 blue yellow |yellow blue- black violet clear clear clear clear clear
Using the DNA figure below to identify structures of the following letters: A= B= C= D= E= F: Circle a nucleotide for each backbone strand A B A G G A E T