DNA The substance represented by the scissors shown cutting the DNA is

Use the plasmid to answer the following questions a) Digest the plasmid with EcoRI only and then both EcoRI and BamHi together. Fill in the table to show the fragment sizes produced.

5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.

DNA Why was salt used in the extraction solution?

I’m having trouble which is not a correct statement. Can you pose explain this problem?

The enzyme is used to remove tension from the DNA double helix during replication called?     Restriction endonuclease   Gyrase   DNA polymerase   Helicase   Ligase

please help me complete this table, I have done mine, so I need correct answer to match with.

Please help me describe in detail the process of DNA replication. Can you please include all enzymes involved and the leading and lagging strands. Also is there any way to make it more understanding than the text books im having trouble understanding it.

DNA strand  1 (template) TACATGCTCGTGACTTTT  Mutation in strand 1 TACATGTCGTGACTTTT DNA Strand 5 (template) TACAGGTGTTCCCAGATCGGG Mutation in DNA strand 5 TACAGGTGTTCCCATATCGGG 1.use the original (template) strand of DNA to find the correct amino acid sequence in the DNA. 2.find and highlight the mutation in the DNA. 3.Find the new sequence of the amino acids for the protein in the new mutated strand of DNA. 4.Determine if this mutation is a point mutation of a Frame shift Mutation. 5.Determine if it is a silent mutations, Missense mutation, Nonsense mutation, Insertion or Deletion. 6.will this new protein function the same as the old protein? Why or why not?