DNA sense strand DNA anti-sense strand mRNA tRNA   Which nucleic acids have the same nucleotide sequence (except T in DNA and U in RNA)? Which nucleic acids are complementary (A with T/U and G with C) to each other?

short answer

Determine the complementary DNA strand that would form. Next, write the mRNA that would form from each complementary DNA strand you created (normal and mutated). Remember that adenine in DNA matches with uracil in RNA, thymine in DNA matches with adenine in RNA, and guanine and cytosine go together. Normal DNA strand - CTG ACT CCT GAG GAG Mutated DNA strand - CTG ACT CCT GTG GAG

The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.

Please type answer no write by hend.

Tropomyosin is a two-stranded, 70-kDa muscle protein shown below. Estimate the length of the molecule. Type your answer...

If a DNA strand with the sequence GGCATGCCTATGCGA is transcribed, which of the following accurately represents the newly synthesized mRNA strand?   Question 10 options:   GGCATGCCTATGCGA   CCGTACGGATACGCT   CCGUACGGAUACGCU

Below is a segment of RNA, transcribed from a DNA sequence. Use the codonchart to help answer the questions below. 5’ AUG/CCU/ACG/GAC/UGG/CCU 3’ a. What polypeptide would be generated by this sequence? b. The RNA is mutated to: 5’ AUGCCCACGGACUGGCCU 3’. What type of mutationhas occurred? Show the new polypeptide chain. c. The RNA is mutated to: 5’ AUGCCUACGGACGGGCCU 3’. What type of mutationhas occurred? Show the new polypeptide chain. d. The RNA is mutated to: 5’ AUGCCUACGGACUGACCU 3’. What type of mutationhas occurred? Show the new polypeptide chain.

Write an RNA structure having 8 nucleotides. In a handrwitten form thank you