Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Topic Video
Question
________ strand will remain as half of the ________ molecule.
a. antisense, DNA
b. template, final DNA
c. sense, mRNA
d. codon, anticodon
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 3 steps
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Transcription is similar to DNA replication because both processes_______ . a. use the same enzyme b. copy both strands c. require the same nucleotides d. proceed in the 5′ to 3′ directionarrow_forwardIn observing replication of prokaryotic plasmids by electron microscopy, it is apparent that: a. replication is initiated at two distinct origins of replication. b. the template strands completely unwind before replication begins. c. replication initiates from a single origin, creating a replication bubble d. the plasmid is linearized prior to replicationarrow_forwardUsing the coding strand of a DNA molecule below, what will the first 6 bases of the template strand be? 5’ ATAGATGAAGCCCCACGCCTA 3’ (coding strand of DNA) 3’ 5’ (template strand or non-coding strand of DNA) 5’ 3’ (mRNA strand) a. UAUCUA b. GCGAGT c. TATCTAarrow_forward
- Which of the following enzymes is NOT involved in DNA replication? a. DNA Polymerase b. Primase c. Helicase d. Phosphatase e. DNA Ligasearrow_forwardRNA can function: please explain your answer a.A) as a non-permanent template to synthesize protein b.B) to recruit the correct amino acid during translation c.C) as part of ribosomes to synthesize protein d.D) to help initiate DNA synthesis during replication e.Only A and C Only A, B and C A, B, C and Darrow_forwardWhich statement regarding DNA replication is false? A. On a DNA strand that is being synthesized, the 3' end is growing B. On a DNA strand that is being synthesized, the 5' end is growing C. On a DNA strand that is being synthesized, both 3' and 5' ends are growing D. All of the above E. None of the abovearrow_forward
- A DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this, what is the nucleotide sequence of the MRNA strand that is transcribed? a. ATC CAA GÁC TGG b. TAG GTT CTG ACC c. UAG GUU CUG ACC d. AUC CAA GÁC UGGarrow_forwardWhich of the following statements are NOT true? A. Replication is the process of making DNA and takes place in the nucleus of prokaryotic cells. B. Translation produces a polypeptide that may require additional processing to become a functional protein C. Transcription starts at the promoter of eukaryotic cells and scans until reaches the start codon. D. Splicing results in exons being put together and introns being removedarrow_forwardDNA replication starts with the helicase enzyme binding to the Select one: a. replication fork b. start codon c. replication bubble d. replication originarrow_forward
- Where does synthesis of the product actually begin in DNA Replication? a. Origin of Replication b. Start Codon c. +1 Start Site d. Primer e. 5'-caparrow_forwardYou have obtained a sample of DNA, and you transcribe mRNA from this DNA and purify it. You then separate the two strands of the DNA and analyze the base composition of each strand and of the mRNA. You obtain the data shown in the table below. Which DNA strand is the coding strand? A G C U DNA Strand #1 19.1 26.0 31 23.9 DNA Strand #2 24.8 30.9 24.5 19.6 MRNA 19.0 25.9 30.8 24.1 DNA Strand # 1 Cannot tell from this information Both DNA strands DNA Strand # 2arrow_forwardMedgie is creating his science fair project on DNA replication. His final display board shows the following. Human DNA Replication Steps Step 1 DNA unwinds in the nucleus Step 2 Complementary base pairs are deleted Step 3 DNA rewinds back together Step 4 The newly made DNA helix is placed in a cell formed in Mitosis According to Medgie's project, which of the following identifies and explains which of the steps is incorrect? O Step 4 is incorrect because not all human cells require DNA. O Step 3 is incorrect because the DNA remains unwound to be transcribed into RNA. Step 2 is incorrect because the complementary base pairs are used as a template, not deleted. Step 1 is incorrect because DNA doesn't unwind in the nucleus, instead it unwinds in the cytoplasm Previousarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education