Distinguish between sensory and motor pathways in terms of direction and type of information conveyed. Include the name of two spinal cord pathways from the sensory and motor divisions of the nervous system.

Q: How many atoms make up one carbon dioxide (CO2) molecule? How many different types of atoms are…

A: Biomolecules are the macromolecules required by biological cells for their survival growth, and…

Q: Name the commonly used vector for cloning genes into higher organisms.

A: A vector is essentially a DNA molecule (typically like plasmids or viruses) utilised in molecular…

Q: How can you distinguish growth from development?

A: Life starts with a single cell and becomes a complex organism during the course of growth and…

Q: Explain monohybrid cross with a suitable example

A: Monohybrid cross is a cross which deals with only one character. This character is represented by…

Q: 14. What is required to convert Ribulose bisphosphate to 3-phosphoglycerate (PGA)? a. b. the…

A: The answer is--- d. The addition of CO2 and water is required to convert ribulose bisphosphate to…

Q: Which of the following is true about MHC? Check all that apply.   A. MHC I is expressed in all…

A: Major Histocompatibility Complex(MHC) is basically a group of genes on DNA.It mainly helps the…

Q: What are the genotype and phenotype ratios of potential offspring when a man with type AB blood…

A: Blood groupings are inherited. They follow a Mendelian pattern, which means they are the result of a…

Q: Viruses are not typically considered living organisms because they contain no biological molecules…

A: A virus is a small infectious agent that consists of genetic material (DNA or RNA) surrounded by a…

Q: Which of the following general transcription factors are indicated as "minimally required" for…

A: Transcription factors are proteins that "bind to promote areas and aid in the initiation of…

Q: Define interference competition. Give one example that supports competitive exclusion occurring in…

A: Competition is usually seen betwen same species or organisms. These organism are in need of same…

Q: which products of the light independent reactions are used by the light dependent reactions

A: Photosynthesis is the basis of the food chain in terrestrial and aquatic ecosystems; it supports the…

Q: 10 ATP/Acetyl-CoA * 2 acetyl-CoA = 20 ATP 1 GTP/ Acetyl-CoA * 2 acetyl-CoA = 2 GTP 1,5 ATP/ FADH2…

A: The process of cellular respiration is a series of reactions that convert the energy from food…

Q: Angiosperms are considered to be the most highly evolved land plants. Discuss how angiosperms are…

A: Angiosperms are a diverse group of flowering plants that are characterized by their reproductive…

Q: Name the 7 structures of the conductive zone. What is their role?

A: The ear is a complex organ that is responsible for converting sound waves into electrical signals…

Q: Explains, with several scientifically detailed information, how global warming affects the beélugas…

A: Global warming is the rise in global mean temperature.Global warming occurs because of increase in…

Q: Do athletes want a higher or lower VO2max? Explain

A: Introduction: The maximal rate at which our bodies can consume oxygen during exercise is known as…

Q: 7. If an organism that is homozygous recessive for a trait is crossed with a heterozygote, what is…

A: Understanding patterns of characteristics transmission requires knowledge of the fundamental…

Q: What is your own definition of morphology?

A: There can be many aspects to examine organisms like morphological,physilogical,pshycological etc.Now…

Q: Considering the pandemic brought about by COVID-19, there has been plant-based products/ herbal…

A: Nowadays we are very familiar with the deadly virus Covid-19.It form pandemic in 2019-2021.This…

Q: explain why Innate and Adaptive Immunity Are No Longer Black and White but are Increasing Shades of…

A: Immunity has two line of defence against pathogens. The innate immune response serves as the body's…

Q: Explain how the disruptions in the electron transport chain leads to the production of reactive…

A: The electron transport chain is a series of protein complexes and electron carriers that are located…

Q: Importance of research and development in heartvalves

A: Introduction: Hemodynamic heart valves ensure that blood flows through the heart in a single…

Q: article: Dolly the sheep 1. Mention 2 failed attempts on mammal cloning.  2. What did you learn…

A: Dolly was "female Finnish Dorset sheep"  and is the  first mammal cloned by using the process of…

Q: 1. A stain turns one bacterium green and a different bacterium blue. This would be called a gram…

A: Some bacteria can cause disease in humans, animals, and plants. Examples of harmful bacteria include…

Q: List examples of the synthetic, metabolic, and excretory functions of the kidney

A: Understanding the functioning of the body's systems is essential for several reasons. By…

Q: Per the book the answer to this questions is probability is 0.006.

A: The cross is between parents having genotype AaBb x Aabb. This genotype will produce four and two…

Q: Differentiate between aneuploidy and polyploidy

A: Chromosomal variations refer to any changes or differences in the number or structure of chromosomes…

Q: What is knockdown gene analysis? How is this different from knockout analysis?

A: Gene knockdown is a method in which temporarily stop or decrease the expression of one or more…

Q: In a clinical trial it might seem unethical to compare a drug candidate versus a placebo rather than…

A: The term “Placebo” refers to a substance that is manufactured to have no therapeutic value. For…

Q: 1. On your ovulation chart, mark the unfertile, likely to be fertile, and the most fertile days. Put…

A: Menstrual liquid comprises blood, endometrial cells (uterine lining cells), and mucus. Menstruation…

Q: Given a chance to become a bioentrepreneur, which of the plant products will you be able to place in…

A: The question is about a hypothetical scenario in which a person has the opportunity to become a…

Q: 1. Give the names and functions of the following cellular organelles. a. Mitochondria b. Rough…

A: The research of cell structure and function is known as cell biology, and it is based on the idea…

Q: We measure species density in plant ecosystems, When random sampling and systematic sampling…

A: Random sampling :- Random sampling is a type of the sampling technique in which each sample has an…

Q: snapdragon plant with violet flowers was crossed with another such plant with white flowers. The F1…

A: After the monohybrid cross, Mendel made two generals rules. These general rules are called as law of…

Q: Explain the steps of RNA translation into protein.

A: “Since you have posted multiple questions, we will provide the solutiononly to the first question as…

Q: A patch-clamp device is used to a. Study the properties of individual neurotransmitters b. Study the…

A: A flexible electrophysiological method for analysing ion channel function is the patch-clamp method.…

Q: voltage-gated calcium channel

A: Voltage gated calcium channels(VGCC): These are the transmembrane proteins which play an important…

Q: Which chromosome does this gene CAGATTGTGAAGAGGTCTCTTGA, appear on in the human genome? Answerin…

A: Any gene can exists in two different forms, that are known as alleles. An allele of a gene has its…

Q: shirt (Sample A, n=83, Sample B, n = 19). Women at high conception risk were substantially more…

A: First let's try to understand these terms clearly:

Q: 1.2 Answer these "a, b, c" questions, well detailed with a lot of information filled in. It is…

A: Marine creatures such as beluga whales are critical to the health and balance of marine ecosystems,…

Q: Utilitarianism falls into the wider moral theory of... A. imperativism B.consequentialism C.…

A: A moral theory known as utilitarianism favours actions that increase happiness or pleasure and…

Q: Describe what a pseudogene is and what impact they have on gene expression

A: A pseudogene is a nonfunctional gene that can be compared to junk DNA.

Q: Why are petri dishes ALWAYS stored and incubated upside down?   Question 17 options:   a)  helps…

A: ANSWER) Petri dish is a transparent dish which is shallow and is used with the purpose of holding…

Q: DNA and RNA are different because: DNA is made of 4 bases, while RNA is made of 5 bases. DNA is…

A: DNA stands for Deoxyribonucleic acid; which contains cytosine, thymine, adenine and guanine as…

Q: In moose, brown coat color (B) is dominant to albino (no pigment) (b) and rough coat (R) is dominant…

A: In genetics, dominant and recessive refer to the relationship between two versions of a gene, called…

Q: Explain how cardiovascular, respiratory and gastrointestinal systems ensure that, cells receive the…

A: Cellular respiration is the process in which glucose is broken down in presence of oxygen to produce…

Q: Macromolecule Carbohydrates Lipids Proteins Nucleic Acids Monomer Amino Acids Elements Present C,H,O…

A: Large, naturally occurring cellular components known as biological macromolecules perform a number…

Q: 5. Why is this decision such a struggle for Suzanne and David? Explain how the implications noted at…

A: Alzheimer's disease is a progressive brain disorder that affects memory, thinking, and behavior. It…

Q: What happens after you get a (one) gunshot? Pick a type of tissue. It could be any that might need…

A: Gunshot wounds can cause severe damage to various types of tissue in the body. The healing process…

Q: Consider three yellow, round peas, labeled A, B, and C. Each was grown into a plant and crossed to a…

A: Introduction A gene exists in two alternative forms called alleles. If both the alleles are same, it…

Dissection

Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby understand the physiology of the organism.