determine if the individual is homozygous for presence of the Alu insertion(++), heterozygous (+-), homozygous for the absence of the Alu insertion (-), or if the results are inconclusive (I) (explain what makes you decide your determination, in detail). Explain

For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

1) Do you agree or disagree with this statement? Transposons can cause genomic rearrangements or genomic expansion compared to microsats, which are only associated with genomic expansion. Explain your response.   2)   Do you agree or disagree with this statement? Since bone is a non-living structure, it would not be useful for genomic profiling. Explain.

After mutagenesis of wild type Vibrio fisheri, you isolate two different mutant strains (A and B) that, unlike the wild type cells, fail to luminesce when grown to high density in a flask with appropriate medium. Curiously, however, when you inoculate both mutant strains in the same flask, you observe that the mixed (A+B) culture begins to emit light after growing dense. a) What gene/functions are likely affected in each of the two mutants? b) How does this explain their phenotypes?

Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.:   ACGTATCGCGTATA   GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences.    asap

The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…

A diploid human cell contains approximately 6.4 billion base pairs of DNA. a. How many nucleosomes are present in such a cell? (Assume that the linker DNA encompasses 40 bp.) b. How many histone proteins are complexed with this DNA?

Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are labeled 5, 6, 7, and 8. The two genotypes are mixed in all possible combinations and, after incubation, are plated to determine the frequency of a*b+ recombinants. The following results are obtained, where M=many recombinants, L=low number of recombinants, and 0=no recombinants: 1 3 4 M M 6. M M L M 8 L L Based on these results, assign a sex type to each strain. Answer Bank 2 F- Hfr F+ 3 4

A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing unlabeled (notradioactive) GTP, CTP, and TTP plus adenine nucleoside triphosphate with all its phosphorus atoms in theform of the radioactive isotope 32P. Will both daughtermolecules be radioactive? Explain. Then repeat thequestion for the molecule5′-ATATATATATATAT-3′3′-TATATATATATATA-5′

2c) If the whole potoroo genome is 4.2 x 10' bp, and the highlyrepetitive DNA in the potoroo genome is composed entirely ofcopies of the sequence 5'AAGACT' and its complement, howmany copies of this sequence are present in the potoroogenome?