Create a program that determines how quickly an object is travelling when it hits the ground (we'll label this "final velocity" or v. The user will enter the height from which the object is dropped a distance (d) in meters (m). Your output should be formatted such that you always display ONE digit after the decimal place for the final velocity (e.g.: 20.2, 15.5, 10.0, etc.) Because the object is dropped from some height, you may assume its initial speed (v) is O meters-per- second (m/s). We are on Earth using metric values for our calculations; therefore assume acceleration (designated a in the following formula) due to gravity is 9.8m/s? You can use the following general formula to find the final speed v Vf = Vv? + 2ad Again the initial speed, v, is zero, since we are dropping the object. Acceleration, a, has been given to you since we are on Earth. The distance, d, is input by the user. • Don't forget: Include a flowchart that describes your program's operation (this will be counted as part of your grade as 'documentation' in the grading rubric) Sample Output: = RESTART: /Users/keithbagley/Dropbox/NORTHEASTERN UNI ork/HW1/gravity.py Final velocity calculator What is the height/distance (in meters): 100 The object will hit the ground at a speed of 44.3 m/s. AMAZING points: These final two points may be awarded if you've completed the rest of the assignment perfectly and blown us away with. Using constants where appropriate Using round or format functions only for printing out, and do not save any values that have been rounded off, floored, etc.

Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca…

If you look at the first compound notation, what does it mean?