Compare 2D polyacrylamide gel electrophoresis to LC-MS as a proteomics technique to identify differences between patients with a disease and controls without the disease.
Q: In photosynthesis which percentage of oxygen produced is used for cellular respiration in the plant?…
A: The oxygen that is released in the photosynthesis is used in the cellular respiration by the plants.…
Q: To determine: How chloroplasts generate a larger proton gradient across the thylakoid membrane than…
A: For living functions, that is when it comes on to the term that the cell eukaryotic cells require a…
Q: 4. Show a cross for a sickle cell inheritance of a woman who is homezggus, for the disease and a man…
A: Sickle cell disease (SCD) is a group of inherited RBC-related disorders in which the red blood cells…
Q: Compare the auto induction media (AIM) with regular induced protein expression. Which is better when…
A: Most of the eukaryotic proteins are still produced via genetic engineering it into host prokaryotic…
Q: For the number 7.31000 Convert the number to Scientific Notation. If you add1 to the last position…
A: Given number is 7.31000 To do= add 1 in the last position and convert it into scientific notation.
Q: explain the concepts of inflammation
A:
Q: DNA-based
A: In the initial times the genetic material of yhe most of the primitive organisms was the RNA and…
Q: Fetuses whose cells are triploid, that is, contain three full sets of chromosomes, develop to term…
A: INTRODUCTION The DNA molecule is packed into thread-like structures called chromosomes in the…
Q: Explain in 2 or 3 paragraphs- Phenetics vs Cladistics
A: There are few important points that should kept in mind : As we know that classification is the…
Q: Frank uses improper body position to lift a heavy box and strains the muscles in his lumbar region.…
A: Muscle tissue is made up of cells that contract when they are stimulated. When the muscle cells are…
Q: Glycogenolysis is considered to be which of the following? Group of answer choices an example of…
A: Metabolism is a phenomenon takes place inside the body of an organism in which material are either…
Q: To examine: Whether the statement, “The number of c subunits in the rotor ring of ATP synthase…
A: ATP, or adenosine triphosphate, is an organic molecule that provides energy during various metabolic…
Q: Not all Americans are willing to get the covid-19 vaccine, and not all countries have enough…
A: Vaccination : A biological preparation that can be used to activate the immune response in the body…
Q: Identify the different components of the mammalian (human) blood, describe each and give their…
A: The circulatory system is a system that contains the heart, blood vessels, and blood, and blood is…
Q: Whale 100,000 calories 200 kilocalories (kcal) Krill 1,000,000 calories 80 kcal Cellular respiration…
A: The plants and animals produce the organic material which is renewable and it is known as the living…
Q: The hydrolysis of ATP requires a. energy. b. water. C. a high temperature. d. energy and water. e.…
A: Answer is.. Water (b)
Q: similarities and differences of nervous system and endocrine system
A: Organ system: The biological system consisting of a group of organs that work together to perform…
Q: what are 4 antagonistic interaction between two or more species that are exploited to improve…
A: Antagonist interaction between two species is the negative interaction where one species is…
Q: Give the common characteristics of animals that falls under the category of Family: Felidae in…
A: INTRODUCTION Felidae is a clade of mammals belonging to the order Carnivora and is commonly referred…
Q: In owl, barring (B) is sex linked and dominant recessive allele (b) producing solid black color when…
A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…
Q: What population will be directly affected if the sea otters leave the kelp forest? Predict the…
A: The term "population" typically refers to the number of people who live in a specific geographic…
Q: A patient is admitted to the surgery ward for an appendectomy. Describe the layers of muscles the…
A:
Q: Label items of dissected eyes
A: Eyes are the most important part in our body. It is one of the sence organ.
Q: 6. What in the small intestine increases the surface area to allow for more absorption? A. Mucus B.…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: PAMPS, TLRs, interferon
A: Human immunodeficiency virus (HIV) is a virus which attacks the human (body's) immune system. it…
Q: f your 16x concentrated stock solution contains 20g of Nacl per liter, how much Nacl would one liter…
A: Given:- Concentration of stock solution= 16X NaCl required per litre= 20g NaCl required for 1 litre…
Q: If your 16x concentrated stock solution contains 20g of Nacl per liter, how much NaCI would one…
A:
Q: Describe one function, brought about by the process of meisos, that spermatogenisis and oogenisis…
A: Common function between spermatogenesis, oogenesis and meiosis :-
Q: The gram negative unknown organism that is Enterobacter aerogenes? What kind of the shape of…
A: Enterobacter aerogenes is a proteobacteria which belongs to Enterobacteriales and family…
Q: To examine: Whether the statement "protein tyrosine phosphatases display exquisite specificity for…
A: Protein phosphatases (PPs) regulate a wide range of signalling systems in plants, and their blockage…
Q: why doesn't nalidixic acid affect human cells
A: Quinolones are one of the most commonly prescribed classes of antibacterials in the world and are…
Q: Based on the past activities about constructing of phylogenetic trees, how do you distinguish…
A: When the evolution of different organisms or species from a common ancestor is depicted through a…
Q: To explain: How would an uncoupler Dinitrophenol of oxidative phosphorylation promote weight loss.
A: The organic chemical compound 2,4-dinitrophenol (DNP) It is a biochemically active chemical that…
Q: 4. Describe the process of alternation of generations using any plant phylum as an example. In your…
A: Introduction :- In plants and algae, the most common type of life cycle is generational alternation.…
Q: 8. Which of the following statements about oxytocin is correct? A. Dilation of cervix and baby…
A: Oxytocin is a hormone delivered by the pituitary organ that causes expanded expansion of the uterus…
Q: In which of the following situations would you expect to probably see differences in the speed of…
A: Molecular clock It is a measure of evolutionary change over time.
Q: DNA Sequence Enter DNA sequence below Original sequence ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG…
A: DNA contains the genetic information about the characteristics features of te organism present in…
Q: A black mare is crossed to a chestnut stallion and a bay colored son and a bay colored daughter are…
A: Answer given in step 2 onwards. Please find attachment. Thank you
Q: Dichotomous Key minimum of 10 plant leaves, classifiying leaf type, phyllogeny, margin, shape, and…
A: Compound, serrated, and whole leaves are being regraded. A dichotomous key is a scientific tool for…
Q: 14. An antibody can be best described as a A.white blood cells that engulfs an invading microbe B.…
A: Antibody - A protein made by plasma cells (a type of white blood cell) in response to an antigen (a…
Q: You are walking to class, pondering the intricacies of physiology, when you trip over an uneven…
A: The largest part of the brain is cerebrum. It is divided into two hemispheres, or halves, called the…
Q: List and briefly define the 5 major types of cell attachments in animal cells.
A: Cell attachment is the first step in a process of compartment interactions that are essential for…
Q: Question: please provide your thoughts on whether or not melatonin seems to be a good option for…
A: Melatonin occurs naturally in both plants and mammals. Long associated with the regulation of the…
Q: THE EFFICIENCY OF NATURAL VENTILATION IS DETERMINED BY 1. the frequency of air exchange 2. the…
A: Natural ventilation is one of the most basic methods for reducing energy use in buildings. The need…
Q: INDICATOR FOR EVALUATION OF EFFICIENCY OF WORK OF VENTILATION OF PREMISES OF RESIDENTIAL AND PUBLIC…
A: Answer is.. the content of harmful substances in the air.
Q: THE EFFICIENCY OF EVALUATING THE OPERATION OF THE HOOD 1. carbon monoxide content in air 2. the…
A: The airflow (velocity) at the hood entrance and inside the hood has to be sufficient to collect and…
Q: What is the advantage, if any, of direct development in gnathostomulids? 2. What are the…
A: Gnathostomulids is the marine worm while rotifers are multicellular organism.
Q: Account for the success of parasitic protozoans. Cite specific strategies employed by these…
A: Protozoa are the microorganisms visible under microscope. They are unicellular and Eukaryotic…
Q: Explain why the human body utilizes negative feedback loops verses positive feedback loops to…
A: Answer
Q: Which of the following is inhibited by increased concentration of NADH? Krebs cycle Pyruvate…
A: Molecules like ATP, ADP, NADH regulate enzymes involved in cellular respiration. In pyruvate…
Compare 2D polyacrylamide gel electrophoresis to LC-MS as a proteomics technique to identify differences between patients with a disease and controls without the disease.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Describe two different types of protein microarrays, and discuss their uses.Discuss the principles , uses, advantages and disadvantages of illumina sequencing methodGive a detailed description of how probes are designed and arranged on a resequencing array. Your description should include the size (in base pairs) of the probe, where differences in sequence are located within the probe, and the types of experiments that would use this type of microarray.
- Please briefly explain what gel electrophoresis is and how it works to separate a mixed sample of macromolecules like DNA.Microarray hybridization is used mostly in transcript profiling or assaying DNA variation. Although the technology for establishing DNA microarrays was developed only recently, numerous applications have already been developed and their impact on future biomedical research and diagnostic approaches is expected to be profound. Give some examples of the practical use of this technique.Provide detailed explanation of the following super-resolution techniques: GSD, RESOLFT, SPDM, PAINT or DNA-PAINT.
- Discuss the use of gel electrophoresis for the separation of macromolecules (DNA, RNA and protein) of different sizes and topological forms. (Include the different recombinant DNA techniques that require gel electrophoresis)How proteins are analyzed using gel electrophoretic techniques? Write the differences and uses of 1D and 2D polyacrylamide gel electrophoresis techniques.Discuss the principles, advantages disavantages of DNA and RNA microarrays and Taqman SNP analysis and their uses e.g in pharmacogenomics .
- Which sequence variations are identified by NGS and in which format they are store Discuss in details the software used to identify the effect or nature of these variants. How this information can be used for personalized medicine.Why is it necessary to examine gene-expression profiles, in additionto genome sequences, for effective precision medicine?Briefly outline the steps of DNA extraction as carried out in a lab for the purposes of sequencing, with reference to a published protocol from a company supplying reagents and kits, noting the refinements compared to the protocol used in the online practical. Include the weblink you used.