Q: Distrubuting areteries possesses more smooth muscle in tunica externa? yes or no
A: Arteries are constantly under stress. The aorta and pulmonary arteries, which are closest to the hea...
Q: Auxin causes the bending of shoot toward light by?
A: Auxin class of plant hormones plant-growth regulators) with some morphogen-like characteristics. Au...
Q: Describe how a natural disaster can create an ecological disturbance, and how this can impact biodiv...
A: A geographic area where plants, animals, and other organisms, as well as abiotic factors work togeth...
Q: Which parameter from the software must you adjust in order to permit gene flow? Select One. Startin...
A: Population genetics is study of genetic compositions of populations, with changes in frequencies of ...
Q: Describe the importance of Haworth and Fischer projections on sugars like pentoses and hexoses?
A: --Fischer projection is the 2D representation of an organic molecule by projection . This is mainly ...
Q: Identify the mRNA sequence that encodes the protein Design primers that will allow them to amplify t...
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each o...
Q: Could you give me the answer?
A: 1. Sitting in one place for long hours have many negative effects on our overall health. It results ...
Q: Please help explain this Vpr enhances HIV-1 infection in LAPTM5
A: The HIV protein Vpr, is a multifunctional accessory protein, which is incorporated in virions.
Q: Match the terms or phrases on the left side with the most appropriate choices on the right side. myc...
A: Metagenomics is the study of the collective genetic material from many organisms living together. It...
Q: widow's peak hairline is dominant (W) to a straight hairline (w). Karen and her brother both have a ...
A: Introduction:- A Punnett square is a representation of how different gametes combine to produce dis...
Q: What is the number and types of lamprey species that are present in the Great lakes?
A: ANSWER;- 1. 5 number present in the Great lakes. Many people believe the obtrusive ocean lamprey is ...
Q: Why is the last asymmetric carbon used to establish D/L configuration? Is this an arbitrary choice o...
A: In carbohydrates, those molecules show mirror image is known as enantiomers. It shows absolute conf...
Q: 1. Where and when did photosynthesis first evolve? What are some lines of evidence that support this...
A: The term photosynthesis is associated with a process that can be observed in several living organism...
Q: What are three aspects of your lifestyle that mightdirectly or indirectly contribute to decline in E...
A: Honeybees and many other insects are natural pollinators of a large number of plant species.
Q: 5. In humans, the alleles for blood type are designated IA (A-type blood), I" (B-type blood) and i (...
A: The ABO blood group is based on the presence of specific antigen on the plasma membrane of RBC and s...
Q: 1. Your roommate has noticed that you now spend most of your time studyingmicrobiology and has becom...
A:
Q: What are the various names of articulations based on movement?
A: Articulation is a joint between bones or cartilage in the skeleton of an animal. Joints or articul...
Q: First degree burns requires a. excising the tissue b. waxing c. excising the tissue, wax re...
A: A burn happens whenever skin tissue is damaged by heat, toxins, daylight, electricity, or radioactiv...
Q: D) The root of a binary tree has i) 0 i1) 1 iii) 2 iv) 4 parent(s). E) A node can have 0 or more chi...
A: Introduction: a binary tree is a tree data structure in which each node contains two children that a...
Q: Explain your answer. Below is a pedigree showing the inheritance of colorblindness in Akoto family. ...
A: Colorblindness is a X-linked recessive disorder. X-linked recessive disorders are those which are pa...
Q: A. Draw DENDROBIUM FLOWER according to its sexuality B. Identify whether it is pistillate, staminate...
A: The formation of a new creature through the fusing of gametes is known as sexual reproduction. Howev...
Q: Provide one example of the Fusiform Face Area
A: The fusiform Face Area in simple terms means spindle shaped area. It is also known as fusiform gyrus...
Q: which lampreys are parasitic and which are not in the Great Lakes?
A: The Great Lakes is a series of large interconnected freshwater lakes in the mid-east region of North...
Q: To avoid or lessen sunburn while in the aquatic facility, generously apply sunscreen. Reapply every ...
A: The first statement is correct as the generous application of sunscreen avoids and lessens sunburn. ...
Q: . An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show ...
A: The malting temperature (Tm) of the DNA is the temperature at which at least 50% of dsDNA is conver...
Q: Make simple diagrams tracing the life history of Schistosoma japonicum
A: Schistosoma japonicum: Schistosoma japonicum is a significant parasite and one of the main schistos...
Q: How does a healthy microbiome impact each individual?
A: The microorganisms’ community that can be found inside or on the human body come under the category ...
Q: Why are hydrocarbons insoluble in water? O They are lighter than water. O They are hydrophilic. The ...
A: Hydrocarbons are organic molecules are made up of hydrogen and carbon. The long chains of carbon are...
Q: discuss Euthanasia as an ethical and unethical measure
A: Humans are created in God's likeness, and hence have intrinsic worth or value that transcends all co...
Q: The frequency of single crossover recombinant gametes (those with chromosomes having crossed over) o...
A: Crossing over takes place in prophase I of meiosis that results in exchange of genetic material betw...
Q: Which of the following drugs would least likely cause mydriasis? Cyclopentolate Isoproterenol Epine...
A: 1.The drugs Isoproterenol,epinephrine,Atropine, Glycopyrrolate are cause mydriasis. Answer is 1 for ...
Q: the consumption of excessive amounts of vitamins D and A cause adverse health effects, whereas consu...
A: The substances that our bodies need to develop and function normally are refers as the vitamins. The...
Q: You are studying a transport protein. It appears to bind temporarily to the molecule to be transport...
A: 1. ANSWER;- This is an example of facilitated diffusion. The molecule is a competitive inhibitor. -I...
Q: Explain why you are for or against (a) raising theprice of water while providing lower lifeline rate...
A: Introduction Water is a molecule made up of two hydrogen atoms joined by a covalent link to the cent...
Q: How does the body restore normal blood calcium levels during a state of hypocalcemia (low blood calc...
A: The body maintains a tight grip on the amount of calcium circulating in the blood at all times. This...
Q: Sunhil suffers from a stroke and loses the ability to move his right arm and hand. However, after ph...
A: * stroke mainly affects the shoulder,elbow and upper limb and hand. *Stroke will usually affect the ...
Q: 72. Use Figure 2 to answer the following questions. (1.4) KU HOCH, OH H С — с H. ОН ОН ribose Figure...
A: The molecule given in diagram is Ribose It is a simple sugar and carbohydrate with molecular formula...
Q: How does the swim bladder varies in different aquatic environments?
A: The swim bladder or air bladder is an internal gas filled organ that contributes to the ability to c...
Q: A. Basic Phylogenetic Tree Construction: Create a phylogenetic tree which best represent the data pr...
A: Phylogenetic tree is a diagrammatic illustration which evaluates how the different taxons are relate...
Q: Which type of evidence for evolution is most accurate in determining evolutionary relationships–morp...
A: In biology, evolution refers to changes in an organism' features over numerous generations as a resu...
Q: Photosynthesis runs on the energy of_______ . a. light c. O2 b. hydrogen ions d. CO2
A: Introduction Plants need the green pigment chlorophyll to perform photosynthesis, which produces oxy...
Q: What is the name of the LT receptor which recognize the hla molecules of the graft
A: Introduction:- The human leukocyte antigen (HLA) system (also known as the major histocompatibility ...
Q: If you were asked to build a model of a nucleotide, what structures would you need to represent in t...
A: Nucleotides are the building blocks of DNA as well as other nucleic acids like RNA. The basic elemen...
Q: ACCURATE statement/s for Propranolol: ' Non-cardioselective beta-adrenceptor blocker. Used in the ma...
A: Propranolol is a beta blocker drug that is available under a variety of brand names, including Inder...
Q: How do you describe the synthesis and modification pathway of eukaryotic proteins and lipids that ar...
A: Eukaryotes are organisms the cells have a nucleus enclosed in a nuclear envelope.
Q: PLEASE ANSWER
A: Introduction:- mussels reproduce in an unusual and complex way, which includes a brief, mandatory pe...
Q: State the role of carbon fixation in photosynthesis
A: To define carbon fixation, we must first define fixation. Fixation, in general, refers to the proces...
Q: Phase II drug trials are conducted on animals, while Phase III drug trials are conducted on healthy ...
A: The Food and Drug Administration (FDA) is a division of the Centers for Medicare and Medicaid Servic...
Q: Explain how the three major types of deserts differin their climate and vegetation. Why are desert e...
A: Hi! Thank you for the question, As per the honor code, we are allowed to answer three sub-parts at a...
Q: 1. To create a fully functional protein, how do their structure help in determining its function? 2...
A: 1. A fully functional protein is generally found in tertiary or quaternary structure. The tertiary p...
Cite and explain the factors that led to an enormous bloom of animal diversity in the Paleozoic era.
Step by step
Solved in 3 steps
- Explain why it is difficult to use carbon-14 dating on 100-million-year-old dinosaur fossilsDescribe a scientific hypothesis to explain the mass extinction of dinosaurs and many other organisms at the end of the Cretaceous Period.The extinction of dinosaurs left gaps in the early ecosystems on earth. Explain briefly the aftermath of the dinosaurs extinction in connection with other animal groups.
- Compare and contrast the difference between a prehistoric organism and modern-day organisms. What are the differences and similarities among those organisms?Give typing answer with explanation and conclusion Question 2: Describe the Holocene epoch. How and why has it experienced dramatic changes in the past several decades?Use the scenario to answer the question. A fossil indicates that whales might have started out as small land mammals. This animal was about the size of a wolf and had a diet of meat and fish. While the fossil has the body of a land animal, its head is shaped like a whale with an ear bone that is unique to whales. Which statement is likely true about the fossil? It is not a transitional fossil, but it shows correlation. It is not a transitional fossil, but it shows causation. It is a transitional fossil that shows causation. It is a transitional fossil that shows correlation.
- Fossils that serve as transitional links allow scientists toa. determine how prehistoric animals interacted with each other.b. deduce the order in which various groups of animals arose.c. relate climate change to evolutionary trends.d. determine why evolutionary changes occur.Discuss the Upper Paleolithic cultural period, including innovations in technology, art and burials. Why are the Upper Paleolithic cave paintings significant to the understanding of the Upper Paleolithic?Provide an example in which different features of organisms in the hominin evolutionary lineage evolved atdifferent rates.
- Explain why mammal jawbones may have shifted to being a single solid bone from multiple bones. Explain why the huge increase in diversity is usually attributed to the Cambrian Explosion even though diversity may have actually increased prior to the Cambrian.Using radioactive isotopes to determine the age of a fossil is known as radiometric dating. How might radiometric dating provide support for the theory of evolution by natural selection? Hint—Consider the age of fossils with respect to the overall fossil record (the entire collection of data regarding fossils and the age of Earth).What enabled modern humans to colonize the world? Explain what Dan Lieberman means by "Brains and Brawn?" Include a description and examples of Upper Paleolithic tool technology and at least two specific examples of Upper Paleolithic Art.