Chapter 17: If given the following coding strand of DNA, what is the MRNA? What TRNA will be present? (hint - draw this!) DNA: AAACCGATCCTTAATGGCTTA MRNA: TRNA:

Q: How are translation and transcription different?

A: Transcription is the way toward copying a gene DNA sequence to make a RNA molecule and translation…

Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…

A: The template strand is a DNA strand that functions as a template for the synthesis of complementary…

Q: It is S phase of the cell cycle, and time to replicate the cell’s DNA. Using the following strand of…

A: During the synthesis phase (S-phase) of cell cycle the DNA replication occurs. DNA replication is…

Q: language nitrogen bases Part 5: Translation - the 2nd step in protein synthesis language (A, U, C,…

A: Transcription is the process in which messenger RNA is synthesized with the help of the instructions…

Q: Numerous Xenopus (frog) cells were exposed to varying amounts of ultraviolet light. Some of the…

A: Cells is the structural and functional unit of human body.  Cells are made of cell orgenlles which…

Q: Removal of introns requires a poly-A tail. O a 5' cap. ORNA polymerase enzymes. curling to the…

A: Introduction :- Any nucleotide sequence within a gene that is eliminated during RNA processing to…

Q: 1. How are DNA and RNA different from each other? (Select all that apply.) * RNA is more stable than…

A: Planet's life is extremely varied, ranging from simple single-celled protozoa to intricate…

Q: DNA replication begins at and ends at O start codon; stop codon O AUG; UAG Promoter; operator…

A: The expression of the genetic material occurs generally through the production of proteins,  This…

Q: Use one of the vocabulary words to fill in the blank. Check your spelling. Key Vocabulary from Unit…

A: The ribosome is a special organelle in the cell that is responsible for protein production. The…

Q: During translation, a peptide is PRODUCED , while the MRNA is READ N-->C, 3-->5' 5'-->3'; N-->C.…

A: ANSWER;- N'-- C; 5'--3';

Q: 1. T DNA strand NUCLEUS MRNA CU CYTOPLASM 6. 5. Lysine 7. AAGUUU UGUUCA AA 4. 2.

A: CENTRAL DOGMA-  Replication is the process when DNA replicates itself means it will make copies of…

Q: Which process is the result of the post transcriptional modification of mRNA?

A: The above given statement is about post transcriptional modification.

Q: Which of these molecules is responsible for bringing the correct amino acid to the ribosome? acetyl…

A: Translation is the process by which the cells of the body prepare their own proteins in the…

Q: Transcribe, and Translate from the following DNA segment: DNA:    TAC AGG CTG GAT TTA ATC mRNA:…

A: Central dogma of molecular biology involves transcription and translation. Transcription is the…

Q: BONUS: HIV use HIV Reverse Transcriptase to make a double stranded DNA copy of the HIV genetic…

A: A reverse transcriptase is an enzyme which is used for generation of complementary DNA(cDNA) from…

Q: In the DNA  sequence,the bottom strand is a template strand.if the base pair

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: After the complete ribosome is assembled, what is the first amino-acyl tRNA to enter the ribosome's…

A: In the process of protein synthesis, ribosomes play a crucial role by facilitating the translation…

Q: Match the following with the correct process. converts DNA into mRNA occurs in the ribosome 1.…

A: All new proteins in the cell are formed by conversion of DNA to amino acids.  conversion of DNA to…

Q: Nucleotides - U - T -Sugar & Phosphate - Anticodon - Codon - Ribose - Transcription -…

A: The central dogma consists of DNA to DNA (Replication) DNA to RNA (Transcription) RNA to proteins…

Q: What are ribosomes composed of? tRNA & proteins mRNA & tRNA rRNA & proteins  mRNA & proteins…

A: The ribosomes are composed of two subunits a smaller and a larger and the sizes of prokaryotic and…

Q: ion, mRNA codons, peptide bonds, nucleus.

A: The process of transcription to translation decides the fate of genetic material. Both of the…

Q: TRNA * Carries amino acids in the cytoplasm to ribosomes for protein assembly Amino Acid attachment…

A: The correct answer is (b) amino acid attachment site across from anticodon site on tRNA Transfer…

Q: Which nucleic acid has a double helix structure?     tRNA     mRNA     rRNA     DNA

A: Nucleic acids that are present in the environment can be of two different types based on the type of…

Q: 2. DNA Template:  TTA - CAT - CAT - ATC - GAT - GAC  mrNA: tRNA: Amino acid sequence:

A: All cells divide to give rise to new cells at some specific stage of their life or throughout. The…

Q: which does not play a role in translation?

A: The translation is the process in which the message coded by an mRNA is translated into a sequence…

Q: Sequence: AAA UGG CAA   Is the sequence RNA or DNA? How do you know?   Question 1 options:   You…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: 1: Transcription Transcription DNA nucleotides TAC АСА GAT TTT GTC ACT АТА MRNA codon AUG

A: The method of producing an RNA copy of a gene sequence is known as transcription. This duplicate,…

Q: 1)Which of these molecules is responsible for bringing the correct amino acid to the ribosome? RNA…

A: Translation is the process by which proteins are synthesized using ribosomes. It takes place in the…

Q: Which of the following statement about RNA is FALSE? rRNA is critical for protein synthesis as it is…

A: Ribonucleic acid (RNA) is a nucleic acid which has similar features to DNA and is found in all…

Q: TRANSLATION

A: Central dogma: This theory states that the DNA contains instructions for making a protein which are…

Q: ANALYSIS 1:Given the following sequence of bases present in the DNA coding strand, what will be the…

A: DNA ( Deoxyribonucleic acid ) is a two stranded ladder like helical structure which functions as…

Q: Given the DNA sequence, transcribe it to MRNA, and then find the appropriate Amino Acid. Type your…

A: Codon is described as a sequence of three nucleotides that form a unit of genetic code in…

Q: Think about replication and transcription in a biological cell. Which process would require ligase…

A: INTRODUCTION DNA ligase This is the enzyme that helps in joining two DNA fragments. This enzyme is…

Q: AKS 5c: Which of the following answers below accurately describes Strand C in the model? * Strand A…

A: DNA and RNA are both nucleic acids made up of 4 nucleotides connected to each other in particular…

Q: 17- Choose the answer that has these events of protein synthesis in the proper sequence 1. a tRNA…

A: Protein synthesis is also known as translation. Synthesis of protein occurs from the sequence of…

Q: Ribosome is where the Process of translation takes place Process of moving DNA to the cytoplasm…

A: Ribosomes are made up of both proteins and RNA. These are a part of translational machinery present…

Q: Which process best describes the process of transcription? DNA strands open and both strands are…

A: 1. The process that best describes the process of transcription is: DNA strands open and one strand…

Q: MRNE * Once the MRNA gets to the ribosome, it tries to fell the ribosome the message, but it doesn't…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: 1. Using the DNA provided transcribe DNA into MRNA. 2. Use the mRNA strand you created and break it…

A: # According to our guideline we can answer maximum three sub parts of a questions. So, upload the…

Q: DNA template strand: mRNA codons: tRNA anticodons: polypeptide: 3' end 5' end AGC TTG □ TCC 0 0 0…

A: The method of converting DNA into proteins includes two major steps: transcription and…

Q: Which macromolecule is made by the enzyme reverse transcriptase

A: Option D - cDNA

Q: The ribosome is unique to eukaryotic cells removes introns from RNAs catalyzes the formation of the…

A: Introduction :  Ribosomes are known as protein factory, as they help in the synthesis of proteins.…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.