Can you please annotate the two images attached. • Highlight information • Make notes in margins about main ideas, questions etc. Send a picture of the parts where you annotated Please answer fast
Q: The p75 receptor differs from Trk receptors in that it a) can promote cell death. b) has high…
A: Introduction: P75 receptors, also known as the low-affinity nerve growth factor receptor (LNGFR),…
Q: Please help with this homework assignment…
A: Genome-wide association studies (GWAS) are a type of genetic analysis that looks for associations…
Q: You measure enzyme activity in the presence of compound X and note that when you add sufficient…
A: Introduction: An enzyme inhibitor known as a competitive inhibitor attaches to an enzyme's active…
Q: Which of the following are binding/architectural proteins in the nucleus? a) U1 and U3 and…
A: Nucleus is one of the most important organelle of an eukaryotic cell. It is so because it contains…
Q: What are the pros and cons in regards to legalizing cannabis for either medical or recreational use,…
A: Cannabis is a plant that contains over 100 different chemical compounds, including…
Q: What considerations should be taken when injecting dental blocks in : 1. Cats 2. French Bulldog 3.…
A: Introduction A nerve block is a procedure in which a local anesthetic agent is injected near a…
Q: Yeast produces carbon dioxide gas. Therefore, based only on this information, can we tell whether…
A: No, we cannot determine whether the yeast were using aerobic cellular respiration or anaerobic…
Q: Which of the following is LEAST likely to be expressed in a corpus luteum? progesterone receptors…
A: The ovaries produce egg in each mensural cycle. After the egg is released in the fallopian tube, the…
Q: Direct repair of pyrimidine dimer formation in E. Coli can be accomplished by nucleotide excision.…
A: Escherichia coli, commonly abbreviated as E. coli, is a gram-negative, rod-shaped bacterium that is…
Q: 22. For the Central Dogma of Molecular Biology: Fill in the BOXES to label each(arrow) with: Protein…
A: The Central Dogma of molecular biology is a fundamental principle that describes the flow of genetic…
Q: What disease does this organism cause
A: The above image if of Entamoeba genus.It is a single cell organism with a distinct nucleus. We have…
Q: The appearance of an apoptotic neuron is referred to as a) pyknotic. Ob) microglial. c)…
A: Microglial cells are a type of immune cell that play a role in the brain's immune defense.…
Q: Which of the following does NOT have high potential energy? O ATP O Nitrogen O Glucose O…
A: Introduction :- Potential energy is a form of energy that is stored in an object or a system, and…
Q: How to plants respond to hot, arid conditions? Plants close their stomata to prevent a loss of…
A: INTRODUCTION Stomata It is pores present on the epidermis of leaf, stem and other organs and it…
Q: Nanoparticles were added in a liquid to prompt the medication release, and it was observed that 5 mg…
A: Medication: Medication refers to any substance or drug that is used to treat, cure, prevent, or…
Q: What effect would you expect an antagonist that targets the voltage sensing domain of perisynaptic…
A: Introduction A neuron is a specialized cell that is the fundamental unit of the nervous system. It…
Q: Double-stranded breaks are repaired by a) homologous recombinational repair. b)…
A: *when left unrepaired, double stranded breaks in dna can result in chromosome rearrangements and…
Q: i BI aA✓ | E✓ ✓ ✓ Vascular, spore-producing plants one Show within this Ferns, horsetails, club…
A: Vascular plants are a group of plants that have specialized tissue called vascular tissue, which is…
Q: The development of a) transmembrane proteins b) cell-cell signaling c) dendritic spines is the first…
A: Introduction: A synapse is a specialized junction between two neurons or between a neuron and a…
Q: 3. If a man with hemophilia marries a woman who is homozygous normal and does no have hemophilia,…
A: Haemophilia is an X linked recessive disease meaning the mutation in the only X chromosome present…
Q: CONTROL Baseline Amiloride Forskolin Inh172 Vte (mV) -78 -2 -4 -3 DVRt (mV) 8 16 7.5…
A: To calculate the current flowing through ENaC and CFTR for both vectors, we need to use the values…
Q: What is the name of the hormone produced by the thyroid gland that regulates metabolism?
A: Thyroid gland is the largest endocrine gland of our body. It is located in our neck region. It is…
Q: Which of the following statements about the structure or composition of DNA is FALSE? O DNA is a…
A: Introduction :- DNA (deoxyribonucleic acid) is a molecule that carries genetic information in most…
Q: 1.) Your roommate has noticed that you now spend most of your time studying microbiology and has…
A: Introduction A cell is the basic unit of life and the smallest unit of an organism that can carry…
Q: Pls. suggest a unique research or experiment in relate to biology
A: One unique research or experiment in biology could be exploring the potential of using CRISPR-Cas9…
Q: What are the roles of membrane fluidity in neuron function? What are the roles of conformational…
A: Introduction Membranes are thin layers of lipid molecules that help to form the boundaries of cells…
Q: elect all examples of mutations that are likely to e dominant to wild-type alleles. elect all…
A: Dominant mutations are those mutations which are either present in the homozygous or heterozygous…
Q: Why can we use temperature sensitive genetic screening to identify particular mutants within a…
A: Temperature-sensitive (TS) mutations are rare alleles that are used to study the expression of…
Q: 2. If a plant begins the process of photosynthesis with 50 kCal worth of light energy, how much…
A: Photosynthesis is the process in which the light energy is converted into chemical energy by leaves…
Q: Conservation status of species changes often as new threats arise and current threats subside. Fish…
A: Oceans are getting polluted and being acidicfied as a result it is being difficult for aquatic…
Q: Red-green color blindness means that a person cannot distinguish shades of red and green (usually…
A: Introduction : Colour blindness is an X - linked recessive disease. So if one X chromosome is…
Q: A 2 year old girl presents with a fever and dizziness. She has developed a characteristic rash on…
A: A viral infection is a type of infection caused by a virus. Viruses are small infectious agents that…
Q: what is the difference between a peptide and a protein?
A: Peptides and proteins are both made up of amino acids and are important molecules in many biological…
Q: Imagine you have a plant with a water potential of -0.1 MPa in the root tissue. What would happen if…
A: Given that the water potential in root is -0.1MPa and it was kept in sucrose solution of 0.1M…
Q: Which of the following is NOT a function of auxin? O Fruit ripening Retarding leaf abscission…
A: Auxin is a plant hormone that plays a crucial role in regulating several aspects of plant growth and…
Q: Conduction velocity refers to the [a] at which an action potential travels along a neuron's axon. In…
A: Neurons are specialized cells in the nervous system that transmit electrical and chemical signals…
Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…
A: Genes are hereditary structures on genetic material. These control some specific particular traits.…
Q: Why is Phenol red being utilized in MacConkey agar? Choose among the choices and further explain it.…
A: Introduction MacConkey agar is a selective and differential culture medium used in microbiology for…
Q: Show a diagram showing the process of Mycobacterium tuberculosis on a cellular level
A: Mycobacterium tuberculosis is the bacteria that leads to tuberculosis (TB), a bacterial illness.…
Q: What precautions can be taken to prevent Sporotrichosis in humans?
A: Sporotrichosis is an infection caused by a fungus called Sporothrix which dwells in soil and…
Q: The fish in the diagram at right is best described as... A. A hypo-ionic, hypo-osmotic ammonotele B.…
A: The fish is hypo-ionic, meaning that it has a lower concentration of ions in its body fluids…
Q: Describe the cellular components required for photosynthesis.
A: Photosynthesis is a metabolic pathway that occurs in green plants and some microbes. Through this…
Q: What vitamin is added to the toothpastes aiming to prevent gum inflammation and to improve…
A: Epithelial cells are important for maintaining the integrity of the periodontium, and Vitamin E has…
Q: An aqueous plant found in its natural environment would be in a solution known as: a. Hypotonic b.…
A: Introduction Tonicity refers to the effect of a solution on the movement of water across a…
Q: Peroxisomes will convert acetaldehyde using_______NAD+ Molecules
A: Introduction Peroxisomes are small, membrane-bound organelles found in the cytoplasm of eukaryotic…
Q: Pls.provide the Diagnostic Key Characteristics for Genus ID of cyanobacterium E (SEE IMAGE) using…
A: Cyanobacteria are a type of blue green algae which are brokaryotic in nature. Prokaryotic means that…
Q: an you please annotate the two images attached. Also send a picture of the parts where you…
A: Annotation for figure 1
Q: Why does a sufficiently bright flash of light delivered over a short period of time produce a…
A: Temporary blindness refers to a temporary loss of vision that can occur due to various factors such…
Q: Which of the following factors would increase the oxygen carrying capacity of the blood? A 50%…
A: Oxygen Carrying Capacity: The oxygen carrying capacity of blood refers to the maximum amount of…
Q: Johnson family requests blood typing of their 2-year-old child (father AB, Rh-negative; mother B, Rh…
A: Blood typing is a laboratory technique used to evaluate a person's blood group and Rh factor. This…
Step by step
Solved in 4 steps with 2 images
- Salient Features and Classification of Non-chordates Phylum - Coelenterata (Cnidaria), Phylum - Arthropoda The reproductive processes of two organisms were studied. In Animal I, the offspring generated from a detached part of its body, preferably the tail and in Animal Il the offspring was obtained directly from the ovum without fertilization. Thus, on the basis of the information obtained, the animals can be categorized as (a) Hydra and Bee, respectively (b) Planaria and Aphid, respectively (c) Hydra and Aphid, respectively (d) Both (A) and (B)In eusocial insect societies, explain why sterile workers spend their lives providing for their queen and sisters using Hamilton's rule. (Hello, Please write ur answer in ur own s-ntences, if you can please write your answer to a word document and screen shoot the answer and attach the image here. Please do not plagiarise or I have to give thumbs down. Thank you have a nice day.)It asks to use the development images below to identify one of each of the following in the photos: Zygote -Morula 2-celled stage -Blastula 8-celled stage -Gastrula
- Given that the hatching of eggs and thegrowth rate of blowfly larvae depend ontemperature, how sure do you think forensic entomologists can be about time of death?Give specific reasons (at least 3) why Caenorhabditis elegans have been used by scientists worldwide as a model organism to study various physiological and developmental mechanisms.Liver Flukes Procedure View the preserved liver fluke specimens. Liver flukes are an example of a parasitic flatworm. Also, access this website to learn more about the liver fluke life cycle: http://www.cdc.gov/parasites/fasciola/biology.html 1. Where does the adult liver fluke live? 2. When the liver fluke egg hatches, what organism does it infect first? 3. Can humans become infected? View the preserved tapeworm and the slides of the tapeworm scolex (head) and proglottids (reproductive bodies). This is another example of a parasitic flatworm. Also, access this website to learn more about the tapeworm life cycle: http://www.cdc.gov/parasites/taeniasis/biology.html 1. What structures are located on the scolex to help the tapeworm attach to the host? 2. Are tapeworms hermaphrodites? 3. Name two livestock that can be infected by tapeworms. 4. If a human is infected, where does the tapeworm live?
- In eusocial insect societies, explain why sterile workers spend their lives providing for their queen and sisters using Hamilton's rule. (Hello, Please write ur answer in ur own s-ntences, if you can please write your answer to a word document and screen shoot the answer and attach the image here. Please do not plagiarise or I have to give thumbs down. Thank you have a nice day.)17 of 20 Select the phrase which describes the process of coelom formation by schizocoely O Occurs in protostomes and involves mesodermal tissue that is located in the space between the ectoderm layer and the endodermal wall of the archenteron O Occurs in protostomes and involves buding of mesodermal tissue from the archenteron O Occurs in deuterostomes and protostomes and involves migration of neural crest cells around the interior of the ectoderm cell layer O Occurs in deuterostomes and involves differentiation of endodermal tissue into mesoderm which buds from the primitive gut. O Occurs in protostomes and involves rounding-up endodermal tissue which forms the primitive gut lumenLife cycle complexity Describe a generalized complex life cycle for a parasite that would encompass one or more intermediates hosts and multiple larval stages. Why would this heteroxenic life cycle be an evolutionary advantage over a monoxenic one?
- pict Experimental Planaria #1 Cut in half into front (anterior) and rear (posterior) Day 1 Measuring the Planaria This operation is best performed by removing some of the water from the dish into the lid with a clean pipette and waiting for the worm to stretch out. Measure the length of the worm in millimeters. (Always replace the water right away, you can use the dish lid to transfer water to and from the planarian environment.) A. Record the length of the front (anterior) section just AFTER you cut. This is your INITIAL front length: 5 m m B. Record the length of the rear (posterior) section just AFTER you cut. This is your INITIAL rear length: 3mm C. Observe and record any behavioral responses just after your cut Day 2 Spend time under the microscope observing the cut Planaria. Answer the following questions based on your observations. NO measurements will be taken on this day. a) Are the cut fragments showing signs of regeneration? b) How did you identify the regenerating portion?…Part B. Please turn in typewritten answers to the following questions 1. Asexual reproduction in diatoms occurs when the two valves move slightly apart and the cell divides in a plane parallel to the valves. A new valve is formed which nests within the parent valve. What happens to the average cell size in a population of diatoms reproducing in this manner? How has diatom life history evolved to resolve this issue of changing cell size? Explain. 2. Many benthic invertebrates produce planktonic larvae. Please provide a rationale for a meroplanktonic lifestyle. That is, what are the putative advantages of spending only part of the life cycle in the plankton? 3. Many species of zooplankton will undergo daily vertical migrations, spending the daylight hours lower in the water column and the evening hours closer to the surface. Please speculate as to why so many species display this common behavior.gle Chrome om/mod/quiz/attempt.php?attempt=17129308cmid%-837776 NG SYSTEM (ACADEMIC) In a sponge, reproduction is: CO a. Individuals have both male and female reproductive systems. O b. Individuals either have a male or a female reproductive system. C. Some individuals have only sexual reproduction, while others are entirely asexual. O d. Reproduction is entirely asexual by budding. O e. Individuals have nor reproductive organs, but produce both male and female gametes.