
Computer Networking: A Top-Down Approach (7th Edition)
7th Edition
ISBN: 9780133594140
Author: James Kurose, Keith Ross
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
C++ language
Write a program using Switch statement to perform the following functionalities.
1. Press a to call functionOne.
2. Press b to call functionTwo.
3. Press c to call functionThree.
4. Exit as any other key pressed.(default)
functionOne will return product of all integers entered by user in array of size 8.
functionTwo will perform greatest value in array entered by user.
funtionThree will calculate lowest value in an array entered by user.
Expert Solution

This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 3 steps with 5 images

Knowledge Booster
Similar questions
- Topic: Array covered in Chapter 7 Do not use any topic not covered in lecture. Write a C++ program to store and process an integer array. The program creates an array (numbers) of integers that can store up to 10 numbers. The program then asks the user to enter up to a maximum of 10 numbers, or enter 999 if there are less than 10 numbers. The program should store the numbers in the array. Then the program goes through the array to display all even (divisible by 2) numbers in the array that are entered by the user. Then the program goes through the array to display all odd (not divisible by 2) numbers in the array that are entered by the user. At the end, the program displays the total sum of all numbers that are entered by the user.arrow_forwardIn C++, When an array is passed to a function as a pointer, the function doesn't know the size of the array. List 3 ways to handle this problem.arrow_forwardC++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forward
- C++ Write the program that outputs the following menu. The program should allow a user to input numbers into an array of integers. The array size should be 10. The first number should be stored in the zero position of the array. The next number should be stored in the next available location. Each option below should be written using a procedure, except Quit. Remember to comment the procedures with (given, task and return). (MENU) 1) Input number. 2) Sort numbers. 3) Output numbers 4) Quit Option 1) Allows the user to input a number and store it into the array. If the array is full no more numbers should be input. When the user select option 1 and the array is full it should output (Memory Full!). This option will only allow one number to be entered. If the user want to input another number they will need to select option 1 again. Option 2) This option should take the array and sort it in ascending order. Use the selection sort to do this. Option 3)…arrow_forwarduse c++ Programming language Write a program that creates a two dimensional array initialized with test data. Use any data type you wish . The program should have following functions: .getAverage: This function should accept a two dimensional array as its argument and return the average of each row (each student have their average) and each column (class test average) all the values in the array. .getRowTotal: This function should accept a two dimensional array as its first argument and an integer as its second argument. The second argument should be the subscript of a row in the array. The function should return the total of the values in the specified row. .getColumnTotal: This function should accept a two dimensional array as its first argument and an integer as its second argument. The second argument should be the subscript of a column in the array. The function should return the total of the values in the specified column. .getHighestInRow: This function should accept a two…arrow_forwardC++ Array Expander -Just do everything in main and make sure you comment each step Use Pointer Notation for the function and within the function. Use a main function and return the pointer from the ArrayExpander function to mainarrow_forward
- C++arrow_forwardProgramming Language: C++ I really need help with this question and I keep getting repost answers. Please, someone, help with a genuine understanding of the problem. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE];…arrow_forwardProgramming Language: C++ 4. Select the two correct statements about stub functions: Select one or more: a. stubs are used to test the functionality of a program b. stubs must return a value c. stubs are programs that test if a called function returns the correct result d. stubs are simpler than the functions they replacearrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Computer Networking: A Top-Down Approach (7th Edi...Computer EngineeringISBN:9780133594140Author:James Kurose, Keith RossPublisher:PEARSONComputer Organization and Design MIPS Edition, Fi...Computer EngineeringISBN:9780124077263Author:David A. Patterson, John L. HennessyPublisher:Elsevier ScienceNetwork+ Guide to Networks (MindTap Course List)Computer EngineeringISBN:9781337569330Author:Jill West, Tamara Dean, Jean AndrewsPublisher:Cengage Learning
- Concepts of Database ManagementComputer EngineeringISBN:9781337093422Author:Joy L. Starks, Philip J. Pratt, Mary Z. LastPublisher:Cengage LearningPrelude to ProgrammingComputer EngineeringISBN:9780133750423Author:VENIT, StewartPublisher:Pearson EducationSc Business Data Communications and Networking, T...Computer EngineeringISBN:9781119368830Author:FITZGERALDPublisher:WILEY

Computer Networking: A Top-Down Approach (7th Edi...
Computer Engineering
ISBN:9780133594140
Author:James Kurose, Keith Ross
Publisher:PEARSON

Computer Organization and Design MIPS Edition, Fi...
Computer Engineering
ISBN:9780124077263
Author:David A. Patterson, John L. Hennessy
Publisher:Elsevier Science

Network+ Guide to Networks (MindTap Course List)
Computer Engineering
ISBN:9781337569330
Author:Jill West, Tamara Dean, Jean Andrews
Publisher:Cengage Learning

Concepts of Database Management
Computer Engineering
ISBN:9781337093422
Author:Joy L. Starks, Philip J. Pratt, Mary Z. Last
Publisher:Cengage Learning

Prelude to Programming
Computer Engineering
ISBN:9780133750423
Author:VENIT, Stewart
Publisher:Pearson Education

Sc Business Data Communications and Networking, T...
Computer Engineering
ISBN:9781119368830
Author:FITZGERALD
Publisher:WILEY